Вход в личный кабинет | Регистрация
Избранное (0) Список сравнения (0)
Ваши покупки:
0 товаров на 0 Р
Итого: 0 Р Купить

Гонадотропин на пкт как принимать: Гонадотропин в бодибилдинге

Содержание

Целесообразность использования ХГЧ | Ko4a.ru

Аббревиатура ХГЧ расшифровывается, как хорионический гонадотропин человека. Хорионический Гонадотропин – пептидный гормон, который обнаруживается в теле женщин на ранних сроках беременности, производится он в плаценте. Это фактически индикатор беременности, так как он появляется в крови только в это время. Уровень гонадотропина в крови будет заметным уже через 7 дней после зачатия, а к 2-3 месяцам уровень ХГЧ достигнет предельных значений, и после начинает снижаться.
ХГЧ одобрен FDA для лечения неопущения яичек у мальчиков, для лечения гипогонадизма (снижение производства тестостерона), и для стимуляции овуляции у женщин.
В организме мужчины хорионический гонадотропин при его введении оказывает лютеинизирующее и фолликулостимулирующее действие, то есть проявляет активность лютеинизирующего и фолликулостимулирующего гормонов. По своей структуре ГГЧ похож на эти гормоны и отличается лишь аминокислотной последовательностью. Для того, чтобы внести ясность, придется совершить краткий экскурс в работу эндокринной системы человека. Фолликулостимулирующий гормон (ФСГ) совместно с лютеинизирующим гормоном (ЛГ) вырабатывается в передней доле гипофиза под воздействием гипоталамического гонадотропин-либерирующего гормона. Секреция ФСГ происходит в импульсном режиме с интервалами в 1-4 часа.
У мужчин ФСГ влияет на развитие семенных канальцев, увеличивает концентрацию тестостерона, стимулирует образование и созревание спермы
в яичках и способствует продукции андрогенсвязывающего белка. После полового созревания уровень ФСГ у мужчин относительно постоянный.
ЛГ является гонадотропным гормоном передней доли гипофиза, который определяет функциональное состояние клеток Лейдига яичек, он стимулирует выработку тестостерона у мужчин, благодаря чему происходит и созревание сперматозоидов. Таким образом, введение в организм ХГЧ оказывает на него такое же действие, что и ЛГ и ФСГ одновременно, хотя эффекты ЛГ все же несколько преобладают.
Речь в данной статье пойдет об использовании ХГЧ на стероидном курсе и послекурсовой терапии (ПКТ).

Гипоталамус — Гипофиз – Яички


Применяя тестостерон или его производные, мы нарушаем работу цепи Гипоталамус — Гипофиз – Яички. Гипоталамус фиксирует
рост уровня андрогенов в крови, который мы создаем искусственно и перестает отдавать сигналы гипофизу для выработки вышеуказанных гормонов — ФСГ и ЛГ, соответственно, тестостерон в клетках Лейдига не вырабатывается, ведь его и так уже в избытке. Длительное бездействие клеток Лейдига приводит к их атрофии. В этом заключается одна из основных опасностей применения анаболических стероидов.
Существует три основных цели, для которых применяется ХГЧ в спорте:
  1. На длительном курсе для поддержания работоспособности яичек.
  2. На ПКТ для ускорения «запуска» выработки собственного тестостерона.
  3. Для зачатия во время курса.

Рассмотрим по порядку

Цель #1 – Поддержание работоспособности тестикул на длительных курсах


Зайду издалека, дело в том, что не всё, что человек считает логичным, особенно касательно работы организма, будет являться таковым. То есть, можно предполагать одно, однако на практике это работать не будет, несмотря на то, что на словах звучит убедительно.

Не учитывается огромное число факторов, наличие которых, я думаю, не вызовет ни у кого сомнений.
Не трудно предугадать линию рассуждений человека:
Раз во время использования тестостерона яички не работают, значит, они «спят», а раз спят, то надо их «разбудить», а чтобы добиться их пробуждения необходимо вколоть искусственные гормоны гипофиза – ЛГ и ФСГ и тогда они проснуться и заработают в полную силу, даже после отмены экзотестостерона. Дело в том, что не существует никаких серьезных медицинских исследований на этот счёт. А опираться на житейский опыт, который никак не связан с эндокринологией, слушать советы «исследователей» и «ученых» с форумов, что подобны забору, на которых «тоже написано», я бы не рекомендовал.

Если неизвестно как вещество работает, и к каким последствиям может привести его использование, не стоит его применять, иначе можно будет пожинать плоды собственных ошибок.
Хотя и эффект плацебо никто не отменял, однако единственного эффекта плацебо не будет достаточно для нормализации гормональной системы после курса ААС. ХЧГ во время курса не ускорит начало восстановления тестостерона после отмены использования ААС.

Тем не менее, рекомендации использовать гонадотропин в период стероидного курса в настоящее время доминируют в неофициальных источниках и обосновываются они тем, что ХГЧ поможет предотвратить тестикулярную атрофию.

Цель #2 – использование ХГЧ на ПКТ для ускорения восстановления гормональной системы


Американский врач доктор Мауро Ди Паскуале в своей книге «Употребление наркотиков в любительском спорте» пишет: «Атлеты употребляют HCG(ХГЧ) для смягчения негативных явлений, появляющихся при прекращении приема стероидов, принимаемых длительное время. Эти атлеты считают, что употребление HCG поможет им быстрее восстановить выработку тестостерона в яичках и довести ее до нормы. Но это мнение все же ошибочно.

Хотя HCG и стимулирует выработку собственного тестостерона, он не воздействует на дугу Гипоталамус — Гипофиз — Яички и не ведет к ее восстановлению. После более или менее продолжительного приема стероидов гипоталамус и гипофиз все же находятся в подавленном состоянии и остаются находиться в нем и при приеме HCG, т. к. выработанный организмом вследствие экзогенного поступления в него HCG тестостерон подавляет эндогенную выработку LH (лютеинизирующего гормона). И как только заканчивается прием HCG, атлет вынужден еще пройти через фазу восстановления. Прием HCG лишь отсрочивает эту фазу».

Я думаю, что здесь всё достаточно понятно и добавить нечего. Использование ХГЧ действительно повысит уровень тестостерона после курса, однако по истечению действия препарата всё вернется на круги своя, восстановление не ускориться.

При этом нельзя быть уверенным на 100 % даже в том, что тестостерон в крови поднимется в ответ на инъекции ХГЧ. Известный в мире бодибилдинга врач-эндокринолог Михаил Клестов рассказывает о своем личном отрицательном опыте: «Терапия гонадотропином 5000 ЕД в неделю на протяжении полугода не привела к увеличению тестостерона не на единицу. То есть реакция может быть очень индивидуальна».

Такие же негативные результаты были получены Нельсоном Вергелем в ходе проведенного им исследования. Вергель является экспертом в терапии тестостероном и автором научной работы «Мужской гид» (Man’s Guide), связанной с использованием мужчинами тестостерона. В его исследовании эндокринологи сравнили эффекты трех веществ: инъекция 5000 ЕД ХГЧ два раза в неделю, инъекция смеси тестостерона (Sustanon) в дозировке 250 мг раз в три недели и ежедневное применение геля, содержащего в себе 50 мг тестостерона. ХГЧ, который использовался в исследовании, носил название Pregnyl и производился фирмой Oragon. Sustanon также был произведен Oragon, а гель, который участвовал в исследовании, назывался Testogel, произведенный Schering. Исследователи давали эти вещества в течение шести месяцев трем группам, состоящим из двух дюжин мужчин с гипогонадизмом (патологическое состояние, обусловленное недостаточной секрецией андрогенов). У всех мужчин уровень тестостерона был ниже 300 нг/дл при норме 400–1000 нг/дл. В итоге ХГЧ лишь увеличил размер яичка по сравнению с другими веществами. Этот эффект совершенно ожидаемый, ведь ХГЧ имеет схожее с лютеинизирующим гормоном действие, которое вызывает рост яичек и увеличенное производство тестостерона.

Но что оказалось совершенно неожиданным в данном исследовании, так это то, что ХГЧ не повлиял на концентрацию тестостерона в крови. Почему так произошло, исследователи не знают, в других, более ранних исследованиях ХГЧ действительно влиял на уровень тестостерона. Возможно, одной из причин этого является то, что субъекты в указанном испытании были в возрасте между 18 и 29 годами, а субъекты в других исследованиях были гораздо старше.
В книге «Анаболикс 2006», автора Вильяма Ллелевелина отмечена другая причина, по которой ХГЧ может быть полезен на ПКТ: «Главная способность ХГЧ – это способность восстанавливать отзывчивость тестикул на эндогенный ЛГ. После длительного периода бездействия, данная способность сокращается, и даже если производство эндогенного ЛГ вернулось в норму, это не значит, что и тестостерон тоже вернулся. Многие знают, что если на курсе тестикулы уменьшились, то их восстановление без применения лекарств идет достаточно долго.
ХГЧ быстро возвращает тестикулам размер и функциональность». Там же автор дает рекомендации по приему: «Обычно мы не должны колоть больше, чем 1500-3000 ЕД каждый 4-5день в течении 2-3 недель. Если увеличить дозу или период, то ХГЧ уменьшит чувствительность к ЛГ у клеток Лейдига, что нам не нужно».

Цель #3 – зачатие ребенка во время курса


Как уже было сказано, при использовании экзогенных половых гормонов, собственный тестостерон перестает вырабатываться, равно, как и ЛФ и ФСГ. мужчина имеет очень мало шансов на зачатие, т.к. количество сперматозоидов и их активность снижены. Данный принцип контрацепции является аналогом женской гормональной контрацепции. Никаких научных исследований
не проводилось, но существуют отзывы с успешными результатами, использовавших ХГЧ для данной цели.

Впрочем, также существуют отзывы, свидетельствующие об успешном зачатии в период даже длительных стероидных курсов без использования при этом гонадотропина. Здесь также все весьма индивидуально.

Я намеренно не рекомендую никаких схем, т.к. не хочу брать на себя ответственность за чужое здоровье. Дозировки и способы администрирования для той или иной цели, можно свободно найти практически на любом форуме. Как пример, протокол д-ра Майкла Скалии — единственный протокол официально признанный Американской ассоциацией эндокринологов для лечения гипогонадизма, вызванного приемом стероидов:

Схема послекурсовой терапии

  • 1-16 день гонадотропин по 2500 ЕД через день
  • 1-30 день кломид по 50 мг два раза в день
  • 1-45 день тамоксифен по 20 мг в день.

Протокол испытан на 19 мужчинах в возрасте от 23 до 57 лет, прошедших 12-недельный курс тестостерона ципионата и нандролона деканоата. Средний уровень ЛГ до курса был 4,5, после курса меньше 0,7, после ПКТ — 6,2

На мой взгляд, применение ХГЧ для ускорения запуска выработки тестостерона и поддержания работоспособности тестикул нецелесообразно.
При употреблении гонадотропина мы вторгаемся в гормональную регуляцию на более высоком, чем при приеме стероидов, уровне — гипоталомо- гипофизарной петли.
Как бы это не парадоксально звучало, но прием тестостерона более безопасен и физиологичен для организма, чем прием гонадоторпина.

0 0 голоса

Рейтинг статьи

Как применять гонадотропин в силовых видах спорта

Как применять гонадотропин в силовых видах спорта

| |

Автор: Климишин Юрий — любитель железа и ветеран «химического» фронта.
Дата: 2015-01-08

Все статьи автора >

Важно! Мы не призываем к употреблению стероидов и других сильнодействующих препаратов. Вся информация дана для того, чтобы те, кто всё же решил их принимать, делали это с минимальным риском для здоровья.

Виды гонадотропина

Гонадотропин бывает двух видов. Хорионический и менопаузальный. Оба варианта очень похожи между собой по химической структуре, но они не идентичны и тем более не взаимозаменяемые.

Хорионический гонадотропин синтезируют из мочи беременных женщин. Менопаузальный — из мочи женщин, которые находятся в постменопаузальном периоде. Оба объединяют в себе свойства лютенизирующего (ЛГ) и фолликулостимулирующего гормонов (ФСГ). Но хорионический больше имитирует ЛГ, а менопаузальный — ФСГ.

В традиционной медицине оба вида этого лекарства применяют при различных половых нарушениях, как у мужчин, так и у женщин. Женщинам гонадотропин помогает при различных проблемах с беременностью и овуляцией.

В силовых видах спорта особенно популярен гонадотропин хорионический. Менопаузальный используется гораздо реже. В основном тогда, когда присутствуют проблемы, связанные со сперматогенезом уже после прекращения стероидного курса и проведения ПКТ (послекурсовой терапии). В частности, менопаузальный гонадотропин можно считать средством последней надежды в случае возникновения серьёзных последствий, связанных с применением прогестинов (нандролон, тренболон, оксиметолон).

В каких случаях может пригодится гонадотропин?

Хорионический гонадотропин, это средство помогающее избежать временной атрофии яичек на курсе ААС. А также восстановить нормальное состояния половых желез, если атрофия уже произошла. В основном это касается атлетов высокого уровня, которые принимают стероиды на постоянной основе и используют огромные дозировки. Естественно, простому любителю подобные эксперименты не нужны.

1. Не принимайте ААС дольше 12-ти недель к ряду и не превышайте дозы тестостерона выше 1000мг в неделю. Избегайте эфиров нандролона, а тренболон используйте только в период сушки. Если же даже соблюдая эти меры предосторожности – яйца всё равно уменьшаются, или вы приняли решение сидеть на вечном курсе – тогда через каждые пять недель делайте три инъекции гонады по 1500 – 2500 МЕ за раз, с периодичностью в три дня.

2. Второй случай, это те же три инъекции гонады в той же дозировке в период месяца – двух отдыха между стероидными курсами. В данном случае мы страхуем себя от атрофии и приводим яйки в живое состояние перед очередным курсом стероидов. Обязательным такой подход не назовёшь, но душевное спокойствие стоит дорогого, согласитесь.

3. Третий случай уже строго обязателен, и без всяких но. Если вы провели несколько полноценных курсов на массу, с небольшим перерывом между ними, а за тем курс на сушку и решили сделать длительный перерыв в стероидной терапии. Месяцев на 4 – 6. Тогда перед началом ПКТ ОЧЕНЬ желательно взбодрить половые железы.

Как это сделать? Объясняю. Ровно спустя один период полураспада самого длинного эфира, который использовался на курсе – вы производите четыре инъекции гонадотропина по 2500 МЕ за раз, каждый четвёртый день. После этого ещё неделю сбиваете эстрадиол (помогут анастрозол или местеролон) и начинаете ПКТ.

Побочные эффекты гонадропина

ОБРАЩАЮ ВАШЕ ВНИМАНИЕ!!! Никогда не используйте гонадотропин на ПКТ. Это лекарство воспринимается мозгом точно так же, как ваши собственные ЛГ и ФСГ – результатом будет неспособность дуги гипоталамус – гипофиз – яички восстанавливать нормальную деятельность. То есть гонада не только не восстанавливает вашу половую систему, а ОЧЕНЬ активно мешает её восстановлению. Это средство профилактики проблем с яйцами, но никак не средство после курсовой терапии. На ПКТ используются ТОЛЬКО селективные модуляторы эстрогенных рецепторов: тамоксифен, кломид и торимифен.

Что касается побочных эффектов гонадотропина, то это, в первую очередь, ароматизация. Проще говоря, гонада легко провоцирует гинекомастию, скопление жидкости под кожей и набор жира. Являясь гликопротеином – то есть пептидом, при чрезмерном увлечении этим лекарством к нему могут образовываться антитела. То есть гонада, в этом случае, перестаёт работать. Это касается тех, кто ставит этот препарат еженедельно вместе со стероидами.

Ну и в теории – злоупотребление гонадотропинами может спровоцировать опухоль половых желез. Повторю, что последние два пункта касаются ТОЛЬКО тех, кто вкалывает в себя избыточные количества этого вещества.

И напоследок. Хорионический гонадотропин стоит не в пример дешевле менопаузального и обычно его более чем достаточно, для простого любителя. Но иногда приходится сочетать его с менопаузальным гонадотропином. Как я говорил выше, это связано с расстройствами половой системы от прогестинов. Так что, если вы полюбили нандролоны или тренболоны – настоятельно рекомендую держать заначку, на случай необходимости приобрести менопаузальный гонадотропин.

ПОХОЖИЕ СТАТЬИ

  1. Обзор фирм-производителей стероидов
  2. Как использовать инсулин для набора массы?
  3. Что такое пептиды и их применение в бодибилдинге
  4. Нужно ли принимать стероиды в таблетках?
  5. Применение Дексаметазона в спорте: эффект, побочка, дозировки

Welcome

Мои мысли Welcome
Мои мысли о море

Все больше и больше я думаю о море. Не хочу сказать, что никогда там не был, просто эта тишина и спокойствие не покидают меня ни на минуту.

Мои друзья часто отдыхают на море – не видя всей прелести и не слушая его. Для них это просто развлечение и отдых. Я вижу это иначе.

Умиротворение и мысли о величии океана. Здесь я могу отказаться от повседневной суеты и полностью погрузиться в свои мысли и отдых.

Вы, наверное, смотрели фильм «Достучаться до небес»? Именно об этом я и говорю. Сценарист похож на меня, и его вдохновение возникло из ниоткуда не зря.

Томас Ян и Тиль Швайгер – талантливые люди, они понимают и верят в то, что сделали при создании этого замечательного фильма.

Посмотрите, и вы измените свое отношение к морю, океану, и вы поймете мои мысли, которые я продолжу освещать здесь чуть позже.

Продолжение следует…

My thoughts on the sea

More and more I think about the sea. I do not want to say that I have never been there, just this silence and calmness does not leave me for a moment.

My friends often rest on the sea – not seeing all the charm and do not listen to it. For them, it’s just fun and relaxation. I see it deeper.

Peace, tranquility and thoughts of the greatness of the ocean. Here I can renounce the bustle of everyday life and completely immerse myself in my thoughts and rest.

You’ve probably watched the movie Knocking on Heaven? This is exactly what I am talking about. The writer is like me and his inspiration came out of nowhere for a reason.

Thomas Jan and Til Schweiger are talented people, they understand and believe in what they did in making this wonderful film.

Try and you change your attitude to the sea, the ocean and you will understand my thoughts, which I will continue to highlight here a little later.

To be continued…

Гонадотропин на ПКТ: правила приема, советы и рекомендации

В организмах и женщин, и мужчин вырабатывается гормон ХГЧ, только с одним отличием. У женщин выработка хорионического гонадотропина человека происходит в процессе развития оплодотворенной яйцеклетки. Он выделяется эмбрионом на стадии развития, а также частью плаценты для поддержания баланса гормонов и контроля развития плода у будущей мамы.

А в мужском организме ХГЧ стимулирует работу яичек для повышения уровня тестостерона во время наращивания мышц. Как принимать гонадотропин на ПТК? Об этом и другом читайте дальше.

Что такое ХГЧ?

Хорионический гонадотропин человека — это нестероидный гормон, обладающий фолликулостимулирующими свойствами. Он позволяет предотвратить атрофию тестикул, а также развитие женских половых признаков у мужчин. ХГЧ по биологическим признакам схож по составу с лютеинезирующим гормоном (ЛГ), что заставляет яички вырабатывать тестостерон с удвоенной силой, так как этот гормон при поступлении в организм подает сигнал в гипофиз, который, принимая его, стимулирует синтез половых гормонов, что делает процесс максимально эффективным и предотвращает риски.

Мнение специалистов

Мнения по поводу приема гонадотропина расходятся. Одни считают, что применение гормона стабилизирует состояние здоровья. Другие, напротив, утверждают, что нет. Гонадотропин воздействует на работу яичек, но никак не повышает качество выработки лютеотропина. Даже будет угнетать гормон лютеотропин из-за повышенного количества вырабатываемого тестостерона.

Как принимать гонадотропин после курса стероидов?

Послекурсовая терапия — это процесс восстановления синтеза гормонов гипофиза после применения препаратов и спортивных добавок в комплексе. Терапия популярна у спортсменов с большим количеством мышечной массы. А также она популярна среди бодибилдеров. Целью ПКТ является минимизация вредных для организма мужчины эффектов после применения курса стероидных гормонов и прогормонов.

Послекурсовая терапия (ПКТ) эффективна после приема больших доз анаболических препаратов для выведения гормонов из организма.

Положительные стороны

Плюсами послекурсовой терапии являются такие факторы, как восстановление гормонального фона мужчины-спортсмена после нагрузок на организм. Это важно для наращивания и сохранения здоровой мышечной массы после тренировок. Такой способ помогает предотвращать олигоспермию и развитие атрофии тестикул. А также позволяет своевременно предупредить другие побочные эффекты.

Главные составляющие

Основными компонентами ПКТ являются антиэстрогены, которые подразделяют на несколько подтипов.

Ингибиторы ароматазы применяют во время курса ПКТ для блокировки женского гормона (эстрогена).

Блокаторы эстрогеновых рецепторов используют после окончания курса терапии. Для того чтобы восстановить собственный баланс тестостерона в организме мужчины, разработано множество средств. Такие препараты применяются после курсов приема анаболиков любой сложности в течение четырнадцати дней. Эти препараты крайне важны для мужского здоровья и поддержания красивого внешнего вида тела.

«Каберголин» или «Достинекс» являются ингибитором в секции пролактина, а используют его на курсе прогестиновых препаратов. Такие средства хорошо стабилизируют уровень пролактина, но компоненты имеют множество побочных действий.

Сколько он используется?

Хорионический гонадотропин на ПКТ используют в течение полутора месяцев (6 недель). Вводить препарат начинают на второй-четвертой неделе курса и продолжают его применение до тех пор, пока анаболический препарат не выведется из организма.

После курса приема ХГЧ переходят на применение блокаторов эстрогеновых групп.

Гормон гонадотропин получают путем очищения мочи беременной женщины. Процесс очищения мочи от лишних составляющих происходит в стерильных условиях. В лаборатории выделяют гормон ХГЧ. А поставляют его в ампулах с порошком для приготовления для инъекций, так как в любом другом виде применять его бесполезно. Он не усваивается организмом.

Искусственное введение препарата тестостерона стимулирует систему гипотоламус+гипофиз+яички, и мозг получает команду прекратить выработку ненужных организму гормонов (гонадолиберина и гонадотропина). Вырабатываемые организмом в большом количестве могут они вызвать уменьшение яичек в размерах и спровоцировать гормональный сбой в организме. Поэтому соблюдение баланса ХГЧ и тестостерона так важно для полового здоровья мужчины, принимающего анаболики.

Начинать послекурсовую терапию можно, когда будет достигнут минимальный уровень концентрации стероидов в теле человека. Если после длительного курса приема препарата с тестостероном рано начать ПКТ, то терапия не будет эффективна. А это значит, что период полураспада стероида не истек. И он будет находиться в теле около трех недель.

Следовательно, восстановление гормонального фона прошло некачественно.

Период полураспада препарата — это временной промежуток, за который препарат должен сократить свою эффективность в два раза.

Начало процедуры

Для тех, кто принимает стероидные препараты длительным курсом, оптимальным вариантом является окончить 3-4-недельный курс.

Спортсменам, использующим тестостерон и его аналоги, советуют применять гонадотропин. Но начинающие спортсмены, которые только приступают к наращиванию мышц, делают много ошибок. Например, начинают увеличивать объем мышц и используют хорионический гонадотропин вместе с другими препаратами, что является грубой ошибкой. Доказано, что применение гонадотропина с анаболическими средствами неоправданно.

Препарат ХГЧ используют для сохранения мышечной массы в условиях сниженной калорийности питания — «сушки».

Как правильно применять хорионический гонадотропин на курсе и после терапии?

Препарат продают в аптеке в виде ампул с порошком, который необходимо развести специальным раствором или очищенной водой. Используют его для подкожного и внутримышечного введения. Для каждого человека дозировку препарата подбирают по его индивидуальным критериям.

Для разведения препарата в домашних условиях требуется, не распечатывая флакон, продезинфицировать резиновую крышку спиртом. После берем стерильный шприц, набираем 2 мл воды для инъекций. Протыкаем иглой (иглу и крышку руками не трогаем) крышку из резины. Медленно вводим содержимое шприца во флакон. Затем вбираем раствор в полость шприца, не вынимая иглу из емкости. Закончив все манипуляции с раствором, делают укол.

Внимание! Раствор применять нужно сразу после приготовления. Также нельзя оставлять содержимое флакона и шприца на открытых солнечных лучах, греть. Хранить гонадотропин нужно в холодильнике при температуре 10-12 градусов.

Как принимать гонадотропин на ПКТ?

Укол в домашних условиях сделать можно, но осторожно. Чтобы не повредить седалищный нерв, так как раствор вводят «в пятую точку», нужно зрительно разделить мягкое место крестом на четыре части. Место предполагаемого укола обработайте спиртом до и после введения препарата.

Верхняя часть ягодицы — оптимальная зона для введения раствора ХГЧ. Колют раствор внутримышечно, рассасывается он быстро, длительность действия составляет 5-6 дней.

Единственно верной рекомендации по дозировке не существует. Можно колоть его трижды в неделю, можно и ежедневно.

Если во время тяжелого курса ХГЧ не использовали, то рекомендуют включать его в состав послекурсовой терапии. Инъекции ХГЧ на ПКТ делают через день в течение 21 дня. Такой курс называется длительным.

«Вечный курс» подходит для спортсменов, которые практически всегда используют анаболики. Они применяют хорионический гонадотропин на постоянной основе. После применения препарата более одного месяца делают перерыв на 1-2 недели.

При применении гонадотропина на ПКТ могут возникнуть нарушения в работе оси гипотоламус+гипофиз+яички. А также это может привести к проявлению сыпи, облысению или усиленному росту волосяного покрова и увеличению размера простаты.

Для женщин-бодибилдеров вариант с гонадотропином после ПКТ и на ПКТ не оправдан.

Негативные отзывы

Отрицательные отзывы о применении гонадотропина на ПКТ также имеются, но в небольшом количестве, так как пишут их обычно люди, которые за короткий срок хотят одновременно похудеть и нарастить немного мышц.

Препарат находится в свободной продаже, что исключает его подделку.

Следовательно, если использование гонадотропина на ПКТ проходит строго по назначению, то проблемы с его применением сводятся к минимуму. Исключение — индивидуальная непереносимость.

Пкт гонадотропин после курса — Электронная регистратура

  • 3 Ноября, 2018
  • Спортивное питание
  • Алиса Чекорская

В организмах и женщин, и мужчин вырабатывается гормон ХГЧ, только с одним отличием. У женщин выработка хорионического гонадотропина человека происходит в процессе развития оплодотворенной яйцеклетки. Он выделяется эмбрионом на стадии развития, а также частью плаценты для поддержания баланса гормонов и контроля развития плода у будущей мамы.

А в мужском организме ХГЧ стимулирует работу яичек для повышения уровня тестостерона во время наращивания мышц. Как принимать гонадотропин на ПТК? Об этом и другом читайте дальше.

Что такое ХГЧ?

Хорионический гонадотропин человека — это нестероидный гормон, обладающий фолликулостимулирующими свойствами. Он позволяет предотвратить атрофию тестикул, а также развитие женских половых признаков у мужчин. ХГЧ по биологическим признакам схож по составу с лютеинезирующим гормоном (ЛГ), что заставляет яички вырабатывать тестостерон с удвоенной силой, так как этот гормон при поступлении в организм подает сигнал в гипофиз, который, принимая его, стимулирует синтез половых гормонов, что делает процесс максимально эффективным и предотвращает риски.

Мнение специалистов

Мнения по поводу приема гонадотропина расходятся. Одни считают, что применение гормона стабилизирует состояние здоровья. Другие, напротив, утверждают, что нет. Гонадотропин воздействует на работу яичек, но никак не повышает качество выработки лютеотропина. Даже будет угнетать гормон лютеотропин из-за повышенного количества вырабатываемого тестостерона.

Как принимать гонадотропин после курса стероидов?

Послекурсовая терапия — это процесс восстановления синтеза гормонов гипофиза после применения препаратов и спортивных добавок в комплексе. Терапия популярна у спортсменов с большим количеством мышечной массы. А также она популярна среди бодибилдеров. Целью ПКТ является минимизация вредных для организма мужчины эффектов после применения курса стероидных гормонов и прогормонов.

Послекурсовая терапия (ПКТ) эффективна после приема больших доз анаболических препаратов для выведения гормонов из организма.

Положительные стороны

Плюсами послекурсовой терапии являются такие факторы, как восстановление гормонального фона мужчины-спортсмена после нагрузок на организм. Это важно для наращивания и сохранения здоровой мышечной массы после тренировок. Такой способ помогает предотвращать олигоспермию и развитие атрофии тестикул. А также позволяет своевременно предупредить другие побочные эффекты.

Главные составляющие

Основными компонентами ПКТ являются антиэстрогены, которые подразделяют на несколько подтипов.

Ингибиторы ароматазы применяют во время курса ПКТ для блокировки женского гормона (эстрогена).

Блокаторы эстрогеновых рецепторов используют после окончания курса терапии. Для того чтобы восстановить собственный баланс тестостерона в организме мужчины, разработано множество средств. Такие препараты применяются после курсов приема анаболиков любой сложности в течение четырнадцати дней. Эти препараты крайне важны для мужского здоровья и поддержания красивого внешнего вида тела.

«Каберголин» или «Достинекс» являются ингибитором в секции пролактина, а используют его на курсе прогестиновых препаратов. Такие средства хорошо стабилизируют уровень пролактина, но компоненты имеют множество побочных действий.

Сколько он используется?

Хорионический гонадотропин на ПКТ используют в течение полутора месяцев (6 недель). Вводить препарат начинают на второй-четвертой неделе курса и продолжают его применение до тех пор, пока анаболический препарат не выведется из организма.

После курса приема ХГЧ переходят на применение блокаторов эстрогеновых групп.

Гормон гонадотропин получают путем очищения мочи беременной женщины. Процесс очищения мочи от лишних составляющих происходит в стерильных условиях. В лаборатории выделяют гормон ХГЧ. А поставляют его в ампулах с порошком для приготовления для инъекций, так как в любом другом виде применять его бесполезно. Он не усваивается организмом.

Искусственное введение препарата тестостерона стимулирует систему гипотоламус+гипофиз+яички, и мозг получает команду прекратить выработку ненужных организму гормонов (гонадолиберина и гонадотропина). Вырабатываемые организмом в большом количестве могут они вызвать уменьшение яичек в размерах и спровоцировать гормональный сбой в организме. Поэтому соблюдение баланса ХГЧ и тестостерона так важно для полового здоровья мужчины, принимающего анаболики.

Начинать послекурсовую терапию можно, когда будет достигнут минимальный уровень концентрации стероидов в теле человека. Если после длительного курса приема препарата с тестостероном рано начать ПКТ, то терапия не будет эффективна. А это значит, что период полураспада стероида не истек. И он будет находиться в теле около трех недель.

Следовательно, восстановление гормонального фона прошло некачественно.

Период полураспада препарата — это временной промежуток, за который препарат должен сократить свою эффективность в два раза.

Начало процедуры

Для тех, кто принимает стероидные препараты длительным курсом, оптимальным вариантом является окончить 3-4-недельный курс.

Спортсменам, использующим тестостерон и его аналоги, советуют применять гонадотропин. Но начинающие спортсмены, которые только приступают к наращиванию мышц, делают много ошибок. Например, начинают увеличивать объем мышц и используют хорионический гонадотропин вместе с другими препаратами, что является грубой ошибкой. Доказано, что применение гонадотропина с анаболическими средствами неоправданно.

Препарат ХГЧ используют для сохранения мышечной массы в условиях сниженной калорийности питания — «сушки».

Как правильно применять хорионический гонадотропин на курсе и после терапии?

Препарат продают в аптеке в виде ампул с порошком, который необходимо развести специальным раствором или очищенной водой. Используют его для подкожного и внутримышечного введения. Для каждого человека дозировку препарата подбирают по его индивидуальным критериям.

Для разведения препарата в домашних условиях требуется, не распечатывая флакон, продезинфицировать резиновую крышку спиртом. После берем стерильный шприц, набираем 2 мл воды для инъекций. Протыкаем иглой (иглу и крышку руками не трогаем) крышку из резины. Медленно вводим содержимое шприца во флакон. Затем вбираем раствор в полость шприца, не вынимая иглу из емкости. Закончив все манипуляции с раствором, делают укол.

Внимание! Раствор применять нужно сразу после приготовления. Также нельзя оставлять содержимое флакона и шприца на открытых солнечных лучах, греть. Хранить гонадотропин нужно в холодильнике при температуре 10-12 градусов.

Как принимать гонадотропин на ПКТ?

Укол в домашних условиях сделать можно, но осторожно. Чтобы не повредить седалищный нерв, так как раствор вводят «в пятую точку», нужно зрительно разделить мягкое место крестом на четыре части. Место предполагаемого укола обработайте спиртом до и после введения препарата.

Верхняя часть ягодицы — оптимальная зона для введения раствора ХГЧ. Колют раствор внутримышечно, рассасывается он быстро, длительность действия составляет 5-6 дней.

Единственно верной рекомендации по дозировке не существует. Можно колоть его трижды в неделю, можно и ежедневно.

Если во время тяжелого курса ХГЧ не использовали, то рекомендуют включать его в состав послекурсовой терапии. Инъекции ХГЧ на ПКТ делают через день в течение 21 дня. Такой курс называется длительным.

«Вечный курс» подходит для спортсменов, которые практически всегда используют анаболики. Они применяют хорионический гонадотропин на постоянной основе. После применения препарата более одного месяца делают перерыв на 1-2 недели.

При применении гонадотропина на ПКТ могут возникнуть нарушения в работе оси гипотоламус+гипофиз+яички. А также это может привести к проявлению сыпи, облысению или усиленному росту волосяного покрова и увеличению размера простаты.

Для женщин-бодибилдеров вариант с гонадотропином после ПКТ и на ПКТ не оправдан.

Негативные отзывы

Отрицательные отзывы о применении гонадотропина на ПКТ также имеются, но в небольшом количестве, так как пишут их обычно люди, которые за короткий срок хотят одновременно похудеть и нарастить немного мышц.

Препарат находится в свободной продаже, что исключает его подделку.

Следовательно, если использование гонадотропина на ПКТ проходит строго по назначению, то проблемы с его применением сводятся к минимуму. Исключение — индивидуальная непереносимость.

Хорионический гонадотропин человека (ХГЧ) – нестероидный пептидный гормон, выделяемый эмбрионом на ранней стадии беременности, а далее трофобластом (часть плаценты) для контроля гормонального фона беременной женщины.

В организме мужчины ХГЧ обладает такими же свойствами, что и лютеинизирующий гормон (ЛГ), а именно, стимулирует работу яичек, в результате чего повышается выработка тестостерона. Атлетами гонадотропин применяется с целью поддержания работы яичек на курсе. Очень часто можно встретить советы по использованию ХГЧ на ПКТ. Это ошибочное мнение. Целью ПКТ является восстановление работы дуги гипотоламус-гипофиз-яички. Гонадотропин, хоть и воздействует на тестикулы, но никак не повышает выработку ЛГ. Даже наоборот — тестостерон, вырабатываемый на фоне приема ХГЧ, будет «давить» ЛГ. Поэтому применение ХГЧ после курса будет лишь оттягивать восстановление.

Правильным вариантом будет использование ХГЧ в конце курса для того, чтобы «разбудить» яички и подготовить их к ПКТ. Если курс длинный, то актуально также проколоть гонадотропин 2 недели в середине курса. Гонадотропин проявляет свою активность в организме до 5 дней.

При использовании ХГЧ стоит помнить, что высокие дозировки и частые инъекции могут привести к снижению чувствительности и даже к полной невосприимчивости яичек к гонадотропинам. Поэтому перерыв между использованием ХГЧ должен составлять не менее 6 месяцев.

Применение ХГЧ: 2-3 недели в конце курса (+2 недели в середине длинных циклов).

Дозировки ХГЧ перед ПКТ: 1000-2500МЕ каждый 2-3 день

Дозировки ХГЧ на курсе: 1000МЕ/неделя, начиная с 3 недели курса.

Примечание: время начала приема ХГЧ зависит от эфиров применяемых стероидов. Если курс состоял из коротких препаратов (пропионат, фенилпропионат, ацетат), то ХГЧ ставится последние 2-3 недели данного курса параллельно приему стероидов, терапия ХГЧ заканчивается одновременно с курсом, после чего начинается ПКТ.

Если применялись длинные эфиры (энантат, деканоат, ципионат и др.), то они будут «фонить» в организме еще около трех недель, поэтому прием гонадотропина будет целесообразно начать через неделю после последней инъекции стероида.

Более подробно о времени начала ПКТ читайте здесь.

После окончания курса стероидов, нужно минимизировать потери в мышечной массе и восстановить свой естественный уровень тестостерона.

Запомните: когда вы оканчиваете курс анаболических стероидов – вы будете худеть всегда. Всегда терять мышечную массу, какой бы ПКТ вы не использовали, какие бы супер методики вы не использовали, вы всегда будете сжигать часть набранной мышечной массы. Почему?

Дело в том, что мужской организм в среднем вырабатываем в сутки +-5мг тестостерона – это одна таблетка метана. Допустим у вас на курсе 700 мг метана в неделю, в день получается 100 мг метана, а естественная дозировка вырабатывается 5мг.

Вот такое преимущество человек получает на химии, дозировка половых гормонов в 20 раз больше чем естественная дозировка обычного человека. Организм не может обеспечить такие количества прироста тестостерона. Вот почему когда человек слазит с курса стероидов, он всегда теряет часть набранной массы.

Вывод: на ПКТ не стоит задача сохранить ваши набранные на курсе мышцы, на ПКТ стоит задача не разрушить их ещё больше чем предусмотрено природой. Когда человек начинает неумело экспериментировать со своей гормональной системой, или когда он дает большие избыточные нагрузки в тренажерном зале.

Нам нужно минимизировать потери

  • Чем больше дозы стероидов вы использовали на курсе, тем больше потери в мышечной массе и силе будут после курса (откат больше).
  • Чем более длительный по времени был курс использования анаболических стероидов, тем больше будет откат после курса.
  • Чем меньше вы используете дозы препарата вы используете во время курса, тем меньше у вас прирост, и потери соответственно меньше, точно так же и по срокам приема.

Уменьшить потери мышц на ПКТ

  • Нужно сконцентрироваться на том, чтобы вернуть естественный баланс половых гормонов. Чтобы была собственная выработка, а женские нужно понизить, потому, как после курса стероидов в результате ароматизации их будет больше.
  • Нужно добиться восстановление либидо, и сперматогенезом.
  • Привести в порядок состояние печени, чтобы билирубин был в норме, для этого помогает кортизол.
  • Холестерин. Хорошее питание, много жирной рыбы, рыбий жир (омега-3) и следим за состоянием холестерина.
  • Снизить уровень кортизола. На курсе мы привыкли работать с очень высокой интенсивностью тренировки, а после курса стероидов эту интенсивность нужно снижать, чтобы понижать уровень кортизола.

Восстановление баланса гормонов

В мужском организме также находиться эстроген, и они находятся в определенной пропорции с тестостероном. Естественная пропорция от 1 к 200мг.
Все в нашей системе регулируется, если у вас много тестостерона, то свой собственный вырабатываться не начинает. Прежде чем поднимать свой натуральный уровень тестостерона, нужно дождаться пока закончится искусственный. Для этого нужно учитывать сроки распада тех или иных препаратов.

Допустим после тестостерон энантата и сустанона нужно ждать

Если в вашей системе много эстрадиола и пролактина, то они очень сильно тормозят выработку собственного тестостерона.

Препараты, которые помогают на ПКТ

Летрозол

Летрозол – против эстрадиола.

Летрозол – блокирует эстроген и стимулирует выработку собственного тестостерона. Опыты показывают что 0.5мг летрозола через 2 дня повышают уровень собственного тестостерона на 50%, а 2.5мг (1 таблетка) через 2 дня повышают на 75% уровень собственного тестостерона.

Прием летрозола

Когда и как начинать принимать летрозол. Есть два варианта использования ингибиторов ароматазы.

Во время курса – нужно использовать в той ситуации, когда у вас избыточная ароматизация, когда ваш организм конвертирует слишком много тестостерона в эстродиол. Увеличивается вероятность гинекомастии, ожирение по женскому типу и т.д.

Достинекс

Достинекс — борется с пролактином. Дозировки такие же, как и у летрозола.

Что способствует более быстрому восстановлению тестостерона.

Более быстрое восстановление тестостерона защищает вас от таких последствий как гинекомастия, ожирение по женскому типу, плохая потенция.

Кломифен цитрат

Более слабый антиэстроген, но лучше стимулирует выработку тестостерона

Тамоксифен цитрат

Более сильный антиэстроген и хуже способствует выработке тестостерона.

Существуют препараты после которых на ПКТ тамоксифен лучше не использовать, это препараты с прогистогенной активностью:

Тамоксифен с этими препаратами лучше не принимать, потому как он увеличивает количество прогистогенных рецепторов, соответственно вы можете получить из-за этого много неприятных побочных эффектов.

Дозировка Тамоксифен цитрат

  • 1 день – 80мг
  • В течение недели по 40мг
  • Потом пару недель по 20мг

Кломид

Дозировка Кломид (кломифен)

  • 1 день – 200мг разделить на 4 приема по 50мг
  • После в течение недели используете повышенную дозировку в 100мг (2 таблетки по 50мг).
  • После этой недели переходите на пониженный прием кломида 50мг в день.
  • Общая продолжительность приема кломида +- 1месяц.

Хорионический гонадотропин человека (ХГЧ)

ХГЧ это лютеинизирующий гормон, это тот препарат который заставляет ваши яички вырабатывать тестостерон. Но это вещь искусственная, поэтому после того как у вас в системе прекратили действовать стероиды ХГЧ работает плохо.

Хорионический гонадотропин человека лучше всего использовать в течение курса и после курса стероидов, для того чтобы ваши яички продолжали производить тестостерон.

Дозировка ХГЧ

  • 2000 ХГЧ через день в течение недели. Понедельник 2000, Среду 2000, Пятницу 2000.
  • Есть вариант использования по 500 единиц ХГЧ каждый день в течение 10 дней.

Провирон


  • Блокирует ароматизацию
  • Блокирует действие глобулина
  • Увеличивает либидо после курса стероидов

Дозировка провирона

  • 50 мг в день, разделить на два приема утром и вечером.

Карсил

Справляется со всеми основными задачами, связанными с печенью. Восстанавливают клетки печени и защищают их.

Дозировка карсила

  • 270мг в сутки — 3 раза в день по 90 мг длительность приема около 3 месяцев.

Для восстановления холестерина

  • Едим Омега-3, рыбий жир, Жирную рыбу.

Повышенное давление на ПКТ

Давление должно быть 140 на 90 ударов в минуту.

Для стабилизации давления существуют такие препараты как:

  • Эналалрил – 5мг в день
  • Метопролол – 50мг в день

Понижение кортизола

Основные катаболики это:

Как колоть гонадотропин после курса стероидов. Хорионический гонадотропин в бодибилдинге

Многие начинающие атлеты, которые так сказать “изучают матчасть”, знают, что на длительных или тяжёлых курсах, либо и то и другое вместе взятое, необходимо обязательно применять Гонадотропин.

Если вы все еще не знаете зачем, когда и в каких дозировках, то прочитайте по ссылке.

Если вы купили гонадотропин в нашем магазине и не знаете как его колоть, то эта инструкция для вас. :

Что содержится в упаковке гонадотропина:

    Ампула с порошком

    Ампула с растворителем — водой для инъекций.

Что нужно что бы приготовить раствор для укола:

    Инсулиновый шприц с длинной иголкой на 1 мл. (1 кубик)

    Обычный шприц 2-5 мл.

    Ватные тампоны

    Спирт

Последовательность действий.

Для начала помойте руки с мылом и протрите ватным тампоном горлышка ампул.

    Распакуйте большой шприц

    Постучите по верхней части ампул, что бы жидкость (части порошка) опустились в основную часть

    Гонадотропин поставляется в ампулах европейского образца. Ничего пилить, как в большинстве наших ампул, не нужно. Горлышко ампулы легко отламывается. На горлышке ампул вы увидите точки. Обхватите ампулу так, что бы большой палец ложился именно на эту точку, а указательный обхватывал ампулу снизу. Усилием направленным вниз, отломите горлышко.

    Возьмите большой шприц. Наберите воду для инъекций.

    Медленно, что бы не образовалось пены, по стенке ампулы с порошком введите воду в ампулу.

    Возьмите инсулиновый шприц.

    Наклоняйте ампулу с раствором, так, что бы игла инсулинки постоянно была в растворе, по мере того, как вы будете забирать жидкость.

Куда колоть гонадотропин.

Готовый раствор гонадотропина содержит 5000 м.е. ХГЧ. Рассчитывать дозировку очень просто. Шприц у нас на 1куб. — 10 единиц. 5000 разделяем на 10, получаем 500. Итого в 1 единице содержится 500 м.е. ХГЧ. Если нам надо вколоть 1000 м.е. ставим 2 деления шприца.

Укол необходимо делать в жировую прослойку, примерно “отступив” 5 см от пупка.

Место укола можно не менять. Перед уколом протрите поверхность кожи ватным тампоном смоченным спиртом.

Возьмите двумя пальцами жировую прослойку (кожу) и оттяните её. Поднесите шприц примерно под углом 45 к коже. Сделайте резкий прокол. Введите необходимое количество единиц препарата.

Храните шприц с хорионическим гонадотропином в верхней боковой нише в дверце холодильника. Инъекции выполняются без замены иглы.

Готовый раствор ХГЧ без потери свойств может хранится 14 дней.

Хорионический гонадотропин человека (HCG) — является гормоном, который вырабатывается плацентой во время беременностии, а затем в неизменном виде выводится с мочой, откуда он экстрагируется и очищается для получения препаратов. Хорионический гонадотропин обладает такими же биологическими эффектами как, лютеинизирующий гормон (гонадотропный гормон или гонадотропин), который образуется в гипофизе.

Эффекты гонадотропина

Стимулирует синтез половых гормонов в яичниках, поэтому имеет такой же спектр эффектов как тестостерон.

Стимулирует сперматогенез.

Усиливает развитие половых органов и вторичных половых признаков.

У женщин стимулирует выработку прогестерона желтым телом, провоцирует овуляцию и поддерживает развитие плаценты.

Физиология гонадотропина

В организме регуляция уровня гонадотропина происходит по механизму обратной связи в оси гипоталамус-гипофиз-яичко:

Гонадолиберин вырабатывается в гипоталамусе и стимулирует выброс гонадотропного гормона.

Гонадотропнин вырабатывается в гипофизе и в норме стимулирует работу яичек, при его недостатки возникает атрофия.

Использование HCG в анаболических целях не оправдано и опасно для здоровья. Во-первых, потому что хорионический гонадотропин менее эффективен по сравнению с анаболическими стероидами. Во-вторых, для получения хорошего эффекта возникает необходимость применения его в больших дозах (более 4000 МЕ в неделю), что может вызвать необратимые нарушения в физиологической оси гипоталамус-гипофиз-яичко. В связи с этим обстоятельством, многие статьи негативно отзываются о HCG, забывая о его истинном предназначении.

Применение хорионического гонадотропина в целях PCT

В бодибилдинге применение хорионического гонадотропина является оправданным и даже необходимым исключительно в качестве PCT для профилактики атрофии яичек. В этом случае, его использование безопасно, так как дозы препарата гораздо ниже, кроме того хорионический гонадотропин позволяет устранить некоторые побочные эффекты анаболических стероидов, а также сохранить набранную мышечную массу. HCG имеет особое значение, если цикл стероидов превышает 4 недели или используются большие дозы. В данном ситуации, хорионичекий гонадотропин не нарушает работу оси гипоталамус-гипофиз-яичко, и, что самое главное, позволяет сохранить функцию яичек.

Гонадотропин для похудения

Относительно недавно было опубликовано исследование британского ученого — эндокринолога A.T.W. Simeons, в котором заявляется, что хорионический гонадотропин может использоваться при похудении с целью сохранения мышечной массы. Ученый считает, что гонадотропин программирует гипоталамус на расход жировых запасов, при этом мышцы остаются защищены от катаболизма. Simeons рекомендует использовать небольшие (а поэтому безопасные) дозы HCG — (125 mg ежедневно на фоне низкокалорийной диеты — менее 500 ккал в сутки. Данную диету практикуют во многих специализированных центрах для похудения. Следует заметить, что во время такого курса необходимо потреблять достаточное количество белка и витаминов.

В настоящее время фармацевтической промышленностью выпускается огромное количество препаратов содержащих HCG. После внутримышечного введения препарат хорошо всасывается. Период полувыведения составляет несколько часов, однако эффект от одной инъекции сохраняется в течение 5-6 дней.

Инъекционный хорионический гонадотропин представляет собой сухое вещество, заключенное в ампулу (флакон). К флакону с HCG должна прилагаться ампула с жидкостью для растворения препарата. Обычно это раствор хлорида натрия. Порошок хорошо растворяется в растворе. Образовавшуюся смесь нужно ввести внутримышечно. Если же вы использовали не всю жидкость, то остатки следует поместить в холодильник. Сухой же ХГГ надлежит хранить в темном месте при температуре не выше +25 градусов Цельсия.

Дозы для анаболического эффекта в среднем составляют 5000 МЕ в неделю. В связи с большой продолжительностью действия уколы можно делать только 1 раз в неделю.

Дозы для PCT зависят от мощности стероидного курса. Если продолжительность курса не превышает 4 недели, используется 1 препарат в небольших дозах, то необходимости в гонадотропине нет. Если продолжительность курса более 4 недель, завышена дозировка, используются 2 или более препарата: делайте 2 укола гонадотропина в неделю по 500 — 1000 МЕ.

Дозы при похудении: делайте один укол гонадотропина по 500 МЕ через день.

При приеме HCG могут возникнуть те же побочные эффекты, что и при приеме тестостерона. Использование гонадотропина в больших дозах или длительное время приводит к подавлению секреции гонадотропин-рилизинг гормона, в связи с чем нарушается функция физиологической оси гипоталамус-гипофиз-яичко. Информация о том, что гонадотропин может приводить к симптомам беременности у мужчин совершено абсурдна и не соответствует действительности.

Производится мужской гормон в клетках Лейдинга, расположенных в яичках, а воздействие на этот процесс оказывает лютеинизирующий гормон. Чем его уровень больше, тем сильнее синтез тестостерона вырабатывается клетками Лейдинга. В свою очередь за синтез лютеинизирующего гормона отвечает гипофиз, который также производит и фолликулостимулирующий гормон, необходимый для регулирования производства спермы (этот процесс называется сперматогенез). Синтез этих гормонов, лютеинизирующего, а также фолликулостимулирующего, зависит от третьего вещества — гипоталамического гонадотропин-релизинг гормона.

Гипоталамус получает сведенья об уровне тестостерона и эстрогенов в организме и регулирует синтез гипоталамического гонадотропин-релизинг гормона, уровень которого зависит от количества эстрогенов. Следует отметить, что цепочка «гипоталамус-гипофиз-яички» является очень сложным механизмом, в состав которого входят различные «сенсоры» и механизмы регулировки. По причине высокой сложности всей системы, ее работоспособность может быть легко нарушена, как минимум на короткий промежуток времени.

Механизм воздействия стероидов на организм


Андрогенные и анаболические стероиды оказывают на организм разное воздействие. Сейчас речь идет только о производстве организмом естественного мужского гормона. ААС, которые не подвержены ароматизации, не способны подавлять синтез тестостерона и как следствие, не влияют на функционирование дуги «гипоталамус-гипофиз-яички». После курсов этих стероидов организм способен восстановиться самостоятельно и достаточно быстро и прием гонадотропина после курса стероидов в данном случае не требуется. К сожалению и рост массы они вызывают весьма незначительный. Это требует от атлетов использования в составе курсов более сильных ААС. Их использование приводит к следующим последствиям:
  • Снижается уровень лютеинизирующего гормона;
  • Увеличивается уровень кортизола;
  • Повышается содержание женских гормонов;
  • Рост количества глобулина приводит к понижению уровня мужского гормона;
  • Возрастает содержание лютеотропного гормона, что ведет к росту молочных желез.
Также стероиды, обладающие высокими прогестагенными свойствами, оказывают отрицательное воздействие на синтез лютеинизирующего гормона. Применение на курсе деки тормозит восстановление синтеза естественного мужского гормона. При этом следует учитывать, что максимальная активность этого стероида отмечается спустя месяц или даже два после начала его употребления. Из этого следует, что прием деки необходимо завершать за месяц до окончания всего курса.

Препараты необходимые для выхода из курса стероидов


Сейчас будет приведена схема приема гонадотропина после курса стероидов, которая позволит практически полностью избавить себя от рисков возникновения побочных эффектов. Обычно рекомендуется принимать от 2000 до 2500 МЕ препарата через 4–7 дней. Предлагаемая сегодня схема предполагает прием от 500 до 1000 МЕ гонадотропина ежедневно в течение 7–10 суток. Таким образом, количество принятого препарата практически не меняется, зато риски побочных эффектов отсутствуют.

Если гонадотропин на выходе из курса можно и не использовать, то тамоксифен или же кломид являются необходимыми в этот период. Для повышения эффективности их стоит принимать в сочетании с провироном. Это приведет к усилению синтеза лютеинизирующего гормона.

Учтите, что можно провирон заменить на аримидекс, что существенно быстрее подавит ароматазу, однако по этой причине может сильно снизиться уровень эстрогенов, что также будет плохо для организма. Вполне можно использовать Бромокриптин, а вот инсулин и метандростенолон будут совершенно не лишними.


Сразу следует сказать, что при выходе из курса, собственно как и во время его прохождения, нужно следить за уровнем гормонов в организме. Одной из основных задач после завершения цикла стероидов является подавление синтеза кортизола. Как известно, для этих целей предназначены антикатаболики, одним из лучших в этой группе препаратов является метандростенолон. Несмотря на то, что этот стероид активно препятствует синтезу естественного гормона, если его принимать с утра, то ни какого негативного воздействия на организм оказано не будет.

Также в роли антикатаболика может с успехом выступить и инсулин. По большому счету этот гормон необходим не меньше, чем прием гонадотропина после курса стероидов. Схем его использования достаточно много, однако лучшей из них является использование двух инъекций на протяжении суток.

Также после завершения приема стероидов, необходимо быстро восстановить уровень пролактина. Для этого лучше всего подойдет Бромокриптин. Благодаря этому препарату в организме не только ускорится синтез гормона роста и лептина, но и повысится либидо. Кроме этого Бромокриптин обладает жиросжигающими свойствами и способен бороться в развитием гинекомастии.

Для стимуляции синтеза естественного тестостерона лучшими остаются кломид и тамоксифен. Ни один другой препарат не может с ними соперничать. Одинаковых результатов можно добиться, принимая ежесуточно 20 миллиграмм тамоксифена либо 150 миллиграмм кломида. Кроме этих двух средств можно использовать трибулус терристерис в количестве 100 миллиграмм на протяжении дня, однако он менее эффективен.

Подробнее о послекурсовой терапии смотрите в этом видео.

Хорионический гонадотропин образуется с плацентой женщин в положении в крайне больших количествах. Исполнив прямую функцию, он выходит вместе с мочой из организма. В медицинских целях его получают из мочи путём экстракции и очистки.

Гормон гонадотропина применяют для излечения от большого количества болезней, в том числе задержки развития в половом созревании и любые нарушения беременности. По своим характеристикам он похож на лютеинизирующий гормон, который производит гипофиз.

Хорионический гонадотропин продаётся в порошковой форме белого цвета, который фасуют по флаконам. Его продают вместе с ампулами и физраствором, который состоит из хлорида натрия и воды, чтобы делать уколы. Сейчас существуют различные варианты форм этого лекарства, разная дозировка, и его выпускают около ста различных производителей. В аптеке такой препарат продаётся без рецепта.

Многочисленные исследования показали, что оральное употребление этого препарата эффективности не имеют. В США проводились эксперименты, доказавшие, что добавки, которые включают хорионический гонадотропин, совершенно не эффективны.

Как действует гормон гонадотропина на человека?

Гормон гонадотропина даёт сигнал из гипофиза в яички, чтобы тестостерон вырабатывался в усиленном количестве. Этот препарат имеет такую функцию, как улучшение качества спермы, при этом как дополнительный бонус увеличиваются вторичные половые признаки, и не только у мужчин, но и у женщин. Но исключительно у женщин сильнее вырабатывается прогестерон, за счёт чего яйцеклетка созревает быстрее. Этот гормон ещё формирует плаценту.

Обычно в организме количество гонадотропина регулируется обратной связью тесного взаимодействия гипофиза, гипоталамуса и яичек. Если гормона в организме не хватает, то яички уменьшаются в объёме, а их функциональность резко понижается. Если вводить искусственно синтетический тестостерон и аналогичных ему препаратов, то организм расценивает это как команду прекратить вырабатывать гонадотропин и гонадолиберин, что приводит к полной атрофии функции яичек и, как следствие, уменьшение их размеров.

ХГЧ в бодибилдинге

Гонадотропин в бодибилдинге крайне важен, так как атлеты, принимающие тестостерон и аналоги, имеют опасность полной атрофии яичек. ХГЧ используется на смешанных курсах для прироста массы мышц, этим пользуются бодибилдеры с небольшим опытом. Потому что у него есть функция повышения тестостерона в организме. Таким препаратом также пользуются и в период «сушки», когда нужно сохранить массу мышц и потребляется исключительно пища пониженной калорийности.

Хорионический гонадотропин совершенно не эффективен при приёме в бодибилдинге с целью анаболиков потому, что он может вызвать множество различных проблем. Синтез тестостерона, который стимулирует этот гормон, оказался ниже, чем подобные ему препараты, но при этом побочных эффектов у него оказалось больше, чем у других. В связи с этим у многих возникает вопрос, а зачем тогда вообще принимать такой сомнительного действия препарат? Основным свойством, которым обладает ХГЧ, является, как уже было сказано, предотвращение атрофии яичек.

Приём гонадотропина для профилактики уменьшения объёма яичек не требует больших дозировок, достаточно малых доз. Из-за небольших дозировок снижается и риск получения побочных эффектов, чем когда он используется в качестве анаболиков. При длительном введении ХГЧ-препарата поддерживает связь между гипофизом, гипоталамусом и яичками функционирующей.

В качестве жиросжигателя

ХГЧ может использоваться в качестве жиросжигателя, но при этом мышечная масса сохраняется. Пока такое исследование проводилось только одно, и преждевременно говорить что-то рано, но было точно установлено, что он сжигает жировые ткани, при этом сохраняя мышечную массу.

Но нужно строго соблюдать принимаемые дозы, которые будут безопасны для организма, а примерно они составляют 125 миллиграмм в сутки. При этом необходимо потреблять строгое количество калорий в день, всего порядка 500 килокалорий. Сейчас уже практикуют такие диеты в центрах похудения. При такой «сушке» нужно потреблять больше витаминов и белковых соединений.

Дозировка препарата

При кратковременном принятии анаболиков, это всегда пять или шесть недель, приём ХГЧ не нужен.

Долгосрочный приём стероидов, а также большая дозировка обязует прокалывать два раза в неделю от 250 до 500 миллиграмм средства. Если гормон в процессе курса не вкалывают, то три недели принимается через день 2 тысячи миллиграмм гонадотропина после курса стероидов.

При «вечном» курсе ХГЧ нужно вводить регулярно, с перерывом на одну или две недели через каждые пять недель приёма.

Противопоказания

У препарата ХГЧ есть несколько противопоказаний:

  • опухоль гипофиза;
  • воспалительные заболевания мочеполовой сферы;
  • гормонально-чувствительные опухоли половых желёз;
  • тромбофлебит.

Но в большинстве случаев здоровье бодибилдеров вполне позволяет безболезненно принимать гонадотропин на постоянной основе. Однако принимать его самостоятельно, рассчитывать допустимые дозы и самостоятельно лечиться от опухолей и серьёзных травм половых желёз категорически нельзя, за этим должен следить только лечащий врач.

Гонадотропин, Гонадотропин хорионический, ХГЧ — является гормональным препаратом, применяется как мужчинами, так и женщинами, цель применения у мужчин: для стимуляции синтеза половых гормонов в наших яичках (тестикулах, гонадах), развития половых органов, а также вторичных половых признаков.

ХГЧ биологически схож с Лютеинизирующим гормоном, при экзогенном поступлении в организм, гипофиз, принимая сигнал, заставляет яички вырабатывать . Уловили смысл? Отлично, значит гонадотропин хорионический позволяет нам повысить наш уровень тестостерона.

А теперь проще — когда мы находимся на курсе стероидов, не важно какой мы принимает стероид, наш организм перестает вырабатывать собственный тестостерон, получается, что яички перестают работать как следует, в следствии возникает атрофия яичек.

Да, часто, когда вы получаете данную информацию, вы говорите: зачем тогда анаболические стероиды, если есть гонадотропин?

Ставить анаболические стероиды более безопаснее, чем ХГЧ, потому как для достижения высокого уровня тестостерона, необходимо ставить огромные дозировки в неделю, порядка 5000 ЕД в неделю, что чревато последствиями

И вот тут возникает собственно вопрос: как и когда, и сколько колоть гонадотропин?

Я, как сторонник небольших дозировок говорю: есть несколько схем приема ХГЧ , разберем их:

1. Прочитав огромное количество научной литературы по данной теме (сейчас говорю про зарубежные источники) на западе, частая схема приема выглядит следующим образом:

Начиная со второй недели, они ставят по 500 ЕД каждую неделю до конца использования курса анаболических стероидов, либо по 250 ЕД дважды в неделю.

2. Ставить гонадотропин с третей недели курса по схеме 3-4-5 недели курса по 1000 ЕД каждую неделю, после перерыв 2-3 недели, далее схема повторяется, кстати, гонадотропин ставится при условии, что курс более шести недель .

3. Более распространенная схема, но в то же время устаревшая: используют гонадотропин на последних неделях курса , например, если курс 12 недель, то ставят ХГЧ начина с 8-ой недели по 1500 ЕД в неделю, до начала ПКТ.

Длительное применение ХГЧ не имеет смысла, так как в ответ на экзогенное поступление, организм начинает вырабатывать антитела.

В следующей части статьи я расскажу, как применяют ХГЧ зарубежные спортсмены, так как я знаком с одним парнем из США (выходец из Беларуси), который выступает в менс физик, смотрю его стримы, общаюсь лично через социальные сети, посещаю его вебинары, так же отвечу на вопрос: используют ли гонадотропин на ПКТ (послекурсовой терапии).

Гонадотропин хорионический 1000 в бодибилдинге. Гонадотропин на длинных курсах. Хорионический гонадотропин и другие препараты, используемые на выходе из курса стероидов

Производится мужской гормон в клетках Лейдинга, расположенных в яичках, а воздействие на этот процесс оказывает лютеинизирующий гормон. Чем его уровень больше, тем сильнее синтез тестостерона вырабатывается клетками Лейдинга. В свою очередь за синтез лютеинизирующего гормона отвечает гипофиз, который также производит и фолликулостимулирующий гормон, необходимый для регулирования производства спермы (этот процесс называется сперматогенез). Синтез этих гормонов, лютеинизирующего, а также фолликулостимулирующего, зависит от третьего вещества — гипоталамического гонадотропин-релизинг гормона.

Гипоталамус получает сведенья об уровне тестостерона и эстрогенов в организме и регулирует синтез гипоталамического гонадотропин-релизинг гормона, уровень которого зависит от количества эстрогенов. Следует отметить, что цепочка «гипоталамус-гипофиз-яички» является очень сложным механизмом, в состав которого входят различные «сенсоры» и механизмы регулировки. По причине высокой сложности всей системы, ее работоспособность может быть легко нарушена, как минимум на короткий промежуток времени.

Механизм воздействия стероидов на организм


Андрогенные и анаболические стероиды оказывают на организм разное воздействие. Сейчас речь идет только о производстве организмом естественного мужского гормона. ААС, которые не подвержены ароматизации, не способны подавлять синтез тестостерона и как следствие, не влияют на функционирование дуги «гипоталамус-гипофиз-яички». После курсов этих стероидов организм способен восстановиться самостоятельно и достаточно быстро и прием гонадотропина после курса стероидов в данном случае не требуется. К сожалению и рост массы они вызывают весьма незначительный. Это требует от атлетов использования в составе курсов более сильных ААС. Их использование приводит к следующим последствиям:
  • Снижается уровень лютеинизирующего гормона;
  • Увеличивается уровень кортизола;
  • Повышается содержание женских гормонов;
  • Рост количества глобулина приводит к понижению уровня мужского гормона;
  • Возрастает содержание лютеотропного гормона, что ведет к росту молочных желез.
Также стероиды, обладающие высокими прогестагенными свойствами, оказывают отрицательное воздействие на синтез лютеинизирующего гормона. Применение на курсе деки тормозит восстановление синтеза естественного мужского гормона. При этом следует учитывать, что максимальная активность этого стероида отмечается спустя месяц или даже два после начала его употребления. Из этого следует, что прием деки необходимо завершать за месяц до окончания всего курса.

Препараты необходимые для выхода из курса стероидов


Сейчас будет приведена схема приема гонадотропина после курса стероидов, которая позволит практически полностью избавить себя от рисков возникновения побочных эффектов. Обычно рекомендуется принимать от 2000 до 2500 МЕ препарата через 4–7 дней. Предлагаемая сегодня схема предполагает прием от 500 до 1000 МЕ гонадотропина ежедневно в течение 7–10 суток. Таким образом, количество принятого препарата практически не меняется, зато риски побочных эффектов отсутствуют.

Если гонадотропин на выходе из курса можно и не использовать, то тамоксифен или же кломид являются необходимыми в этот период. Для повышения эффективности их стоит принимать в сочетании с провироном. Это приведет к усилению синтеза лютеинизирующего гормона.

Учтите, что можно провирон заменить на аримидекс, что существенно быстрее подавит ароматазу, однако по этой причине может сильно снизиться уровень эстрогенов, что также будет плохо для организма. Вполне можно использовать Бромокриптин, а вот инсулин и метандростенолон будут совершенно не лишними.


Сразу следует сказать, что при выходе из курса, собственно как и во время его прохождения, нужно следить за уровнем гормонов в организме. Одной из основных задач после завершения цикла стероидов является подавление синтеза кортизола. Как известно, для этих целей предназначены антикатаболики, одним из лучших в этой группе препаратов является метандростенолон. Несмотря на то, что этот стероид активно препятствует синтезу естественного гормона, если его принимать с утра, то ни какого негативного воздействия на организм оказано не будет.

Также в роли антикатаболика может с успехом выступить и инсулин. По большому счету этот гормон необходим не меньше, чем прием гонадотропина после курса стероидов. Схем его использования достаточно много, однако лучшей из них является использование двух инъекций на протяжении суток.

Также после завершения приема стероидов, необходимо быстро восстановить уровень пролактина. Для этого лучше всего подойдет Бромокриптин. Благодаря этому препарату в организме не только ускорится синтез гормона роста и лептина, но и повысится либидо. Кроме этого Бромокриптин обладает жиросжигающими свойствами и способен бороться в развитием гинекомастии.

Для стимуляции синтеза естественного тестостерона лучшими остаются кломид и тамоксифен. Ни один другой препарат не может с ними соперничать. Одинаковых результатов можно добиться, принимая ежесуточно 20 миллиграмм тамоксифена либо 150 миллиграмм кломида. Кроме этих двух средств можно использовать трибулус терристерис в количестве 100 миллиграмм на протяжении дня, однако он менее эффективен.

Подробнее о послекурсовой терапии смотрите в этом видео.

Хорионический гонадотропин (HCG) – естественный гормон человека, содержащийся в плаценте женщины в период беременности. Для получения ХГЧ в виде препарата используют мочу беременной женщины, которую очищают в лабораторных условиях. Гонадотропин человека по своему действию сходен в лютеинизирующим гормоном, который является предшественником тестостерона.

Применение препарата перорально неэффективно, что доказано многочисленными исследованиями. Эксперименты, проведенные в США доказали полную несостоятельность пищевых добавок, содержащих хорионический гонадотропин. Кроме того, на территории США действует запрет на применение данного вещества.

Действие гонадотропина ХГЧ

По своему действию на организм Human Chorionic Gonadotropin полностью сходен с лютеинизирующим гормоном. Также как и, лютеинизирующий гормон, гонадотропин дает сигнал через гипофиз в яички об усилении выработки тестостерона. Помимо своей способности увеличивать выработку тестостерона, препарат улучшает качество спермы, может делать более выраженными вторичные половые признаки, как у мужчин, так и у женщин. У женщин действие хорионического гонадотропина заключается в усилении выработки прогестерона и ускоряет созревание яйцеклетки. Также он способствует формированию плаценты.

В естественных условиях количество хорионического гонадотропина регулируется обратной связью в цепи взаимодействия гипотоламуса, гипофиза и яичек. Недостаток ХГЧ в организме приводит к уменьшению яичек в размерах и снижению их функциональности. Искусственное введение синтетического тестостерона и его аналогов дает системе гипотоламус-гипофиз-яички понять, что выработка гонадолиберина и гонадотропина не требуется. Следовательно, яички утрачивают свои функции и со временем уменьшаются в размерах.

Применение хорионического гонадотропина в бодибилдинге

Спортсменам, применяющим тестостерон и его аналоги следует обязательно использовать гонадотропин человека для профилактики атрофии яичек. Именно такая функция и является основной у данного препарата. Не слишком опытные бодибилдеры используют хорионический гонадотропин для набора мышечной массы в комбинации с другими препаратами. Его свойство увеличивать выработку тестостерона является причиной для введения ХГЧ в курс. Также его используют на «сушке» для сохранения мышечной массы в условиях сниженной калорийности питания.

Доказано, что использование хорионического гонадотропина в бодибилдинге в анаболических целях не оправдано. Кроме того, его использование может вызывать проблемы со здоровьем. Уровень стимуляции выработки тестостерона данным препаратом существенно ниже, чем при использовании синтетических форм тестостерона, а побочные эффекты существенно выше.

Зачем же тогда его использовать? Основное преимущество, которое может дать применение гонадотропина на курсе анаболических стероидов – это его способность предотвращать атрофию яичек.

При использовании гонадотропина в целях профилактики уменьшения яичек в размерах дозы существенно ниже, чем дозы требующиеся для проявления его анаболического эффекта. Соответственно, риск для здоровья сводится к минимуму при максимальной пользе от препарата. Также хорионический гонадотропин обладает свойством смягчать и устранять побочные эффекты некоторые анаболических средств. Применение препарата допустимо на «сушке» для сохранения мышечной массы. В случае длительного курса стероидов HCG становится просто незаменим для предотвращения потери функциональности оси гипотоламус-гипофиз-яички. На ПКТ использование HCG не рекомендуется.

Как принимать хорионический гонадотропин на курсе и после

Купить ХГЧ можно в аптеке без рецепта в виде инъекций для подкожного или внутримышечного введения. Препарат необходимо развести внутри ампулы специальной жидкостью, которая прилагается к препарату. Колоть хорионический гонадотропин нужно внутримышечно, препарат быстро рассасывается. Длительность действия составляет 5-6 дней.

Короткий курс

Если длительность курса приема анаболических стероидов менее 5-6 недель использовать HCG нет необходимости.

Длинные курсы с превышением дозировок

В случае более длительного использования АС или употребления стероидов в больщих дозировках принимать хорионический гонадотропин нужно 2 раза в неделю в количестве 250-500 МЕ. Если во время тяжелого курса HCG не использовался, рекомендуется включать его в состав послекурсовой терапии. На ПКТ используются дозировки 2000 МЕ препарата. Инъекции делают через день в течении 3 недель.

«Вечный курс»

Для спортсменов профессионалов, которые практически непрерывно используют анаболические стероиды, включить в курс препарат рекомендуется на постоянной основе. После 5 недель применения препарат делается перерыв на 1-2 недели.

Побочные эффекты гормона ХГЧ


Перед тем, как узнать о том, на что способен гонадотропин , для начала давайте рассмотрим эндокринную систему мужчин. А точнее рассмотрим дугу – гипоталамус – гипофиз – яички. Собственно она и представлена на данном рисунке.

Не секрет, что тестостерон в яичках вырабатывается клетками Лейдига, под воздействием ЛГ (лютеинизирующего гормона). Здесь работает зависимость, чем больше ЛГ (хорионический гонадотропин хгч), тем больше тестостерона и наоборот, чем меньше ЛГ, тем меньше тестостерона. Лютеинизирующий гормон вырабатывается напрямую гипофизом, им же производится и фолликулостимулирующий гормон или ФСГ. Основная функция ФСГ заключается в стимуляции сперматогенеза. Основное же влияние на синтез как ЛГ, так и ФСГ в гипофизе оказывает гипоталамический гонадотропин-рилизинг гормон или ГнРГ.

В свою очередь гипоталамус, так сказать считывает информацию об уровне тестостерона в организме и эстродиола в крови человека, и в зависимости от этих показателей регулирует синтез ГнРГ. Если говорить проще дуга гипоталамус – гипофиз – яички, представляет собой многофункциональный и сложный биомеханизм. И как любой сложный механизм, данную дугу легко вывести из строя.

Применение гонадотропина и реакция мужского организма на стероиды

Гонадотропин в бодибилдинге для выхода из курса применяется часто. Конечно, здесь его роль зависит от тех стероидов, которые вы принимаете или принимали во время своего курса. Предлагаю рассмотреть первую таблицу, в ней наглядно отражено каким образом те или иные анаболические андрогенные стероиды, влияют на синтез эндогенного тестостерона.

Препарат

Качества, влияющие на производство эндогенного тестостерона

Подавление производства эндогенного тестостерона

Тестостерон Склонность к ароматизации Сильное
Нандролон Прогестагенная активность Сильное
Норэтандролон Прогестагенная активность Сильное
Метандиенон Склонность к ароматизации Выраженное
Оксиметолон Прогестагенная активность Выраженное
Тренболон Невыраженная прогестагенная активность Умеренное
Флюоксиместерон Легкая склонность к ароматизации* Умеренное
Болденон Легкая склонность к ароматизации Умеренное
Туринабол Нет Умеренное
Дростанолон Нет Ниже среднего
Станозолол Нет Ниже среднего
Оксандролон Нет Незначительное
Метенолона энантат Нет Практически отсутствует
Метенолона ацетат Нет Отсутствует
Этилэстренол Нет Отсутствует

Вы, наверное, обратили свое внимание на тот факт, что некоторые стероиды, практически не оказывают воздействия на функции дуги ГГЯ (гипоталамус – гипофиз – яички). Беда в том, что все препараты данного типа практически не дают сильного прироста мышечной массы, т.е. такие препараты как оксандролон, дростанолон, являются практически бесполезными, заставляющими нас обращаться за помощью к более тяжелым препаратам. Применение, которых в свою очередь может вызвать целый набор различных побочных эффектов.

  1. Уменьшение уровня гормона ЛГ.
  2. Повышенное содержание кортизола в организме (гидрокортизона).
  3. Повышенное содержание эстрогенов в организме, в частности эстродиола.
  4. Повышенное содержание эстрогенов глобулина, отвечающего за связь половых гормонов ГСПГ, что в свою очередь приводит к уменьшению синтеза естественного тестостерона.
  5. Повышенный уровень пролактина, т.е. стимуляция роста молочных желез у мужчин.

Кроме того, ряд стероидов обладает прогестагенной активностью, повышение уровня которого может привести к уменьшению количества синтезируемого ЛГ, а прогестерон в количествах, превышающих норму, оказывает весьма негативное влияние на секрецию ЛГ.

Для тех же людей, кто не желает гадать, что происходит у него в организме в данный момент и были придуманы анализы крови. Советую каждому атлету, использующему стероиды, хотя бы раз за цикл прибегать к их помощи, желательно конечно по окончанию цикла или после того, как закончится стероидный курс.

Хорионический гонадотропин и другие препараты, используемые на выходе из курса стероидов

Буду честен, хорионический гонадотропин в данный период – скорее дань традициям, чем реальная необходимость. Только лишь адекватное использование гонадотропина после курса стероидов вместе с антиэстрогенами может ускорить процесс восстановления естественного тестостерона. Но я склонен полагать, да и не только я, что применять хорионический гонадотропин, стоит только во время цикла ААС и только тем спортсменам, которые не обладают предрасположенностью к ароматизации.

Объясню: гонадотропин рилизинг гормон по своей химической структуре схож с ЛГ и ФСГ. Его избыточное количество в организме, становиться сигналом для гипоталамуса, к прекращению синтеза ГнРГ. То есть, говоря простым языком, гонадотропин не позволяет восстанавливаться секреции ЛГ, что в свою очередь приводит к прекращению синтеза естественного тестостерона.

Применение же гонадотропина в середине курса в отличие от анаболических андрогенных стероидов позволяет уменьшить риск проявления атрофии яичек, в принципе от данной проблемы можно избавиться и после курса, но вот яички с горошину, явно на чувство собственной важности положительно не влияют.

А сейчас давайте рассмотрим схему использования хорионического гонадотропина, позволяющую свести к минимуму риск проявления каких-либо побочных эффектов. Стандартной считается доза по 2000-5000 ME каждые 4-5 суток, реже раз в неделю. Предлагаемая мною схема предписывает, каждодневные инъекции по 500-1000 ME каждая, в течение 7-10 дней. Мы получаем, что общее количество препарата (гормон гонадотропин) остается тем же, но шансы побочек сводятся практически к нулю, что порадует всех атлетов.

Кломид (кломифен цитрат или кломифен компримат) и тамоксифен, в отличие от гонадотропина, я бы все же рекомендовал к приему в период окончания стероидного курса. Желательно в комбинации с провироном, для улучшения получаемых результатов. Поясню: оба этих препарата являются антиэстрогенными блокаторами, именно это их свойство и способствует увеличению синтеза ГнРГ. Применение провирона приводит к снижению уровня ароматазы, а следовательно и к снижению уровня эстродиола в крови. Альтернативой провирону может стать аримидекс, более слабый препарат, но все ровно очень эффективный, за счет скорости своей активации.

В период выхода из курса, в ряде случае небезосновательно будет принимать бромокриптин. И уж точно не лишним в этот период станет инсулин.

Я уже говорил, что по окончанию стероидного курса желательно сходить в поликлинику и сдать анализ крови, а не бросаться на рилизинг гонадотропин. Повторюсь, не поленитесь и сдайте быстрый и безболезненный анализ, который обязательно облегчит вашу атлетическую жизнь.

В приведенной ниже таблице, приведены нормы по содержанию в крови различных веществ, от ЛГ до кортизола и естественного тестостерона.

Сразу скажу, что лучше всего проводить замеры с утра, т.к. содержание различных гормонов утром и вечером, в том числе и гормона гонадотропина , значительно различается.

Собственно теперь вы полностью оснащены знаниями о стероидных курсах и можете самостоятельно принимать решения по мерам необходимым для ликвидации, того или иного дефекта. Гормон гонадотропин вам окажет непосильную помощь, однако существуют и другие препараты, которые могут пригодиться.

Подавление активности кортизола

Для снижения уровня кортизола необходимо:

1. Поддерживать на стандартном уровне потребление белка, данный уровень не должен снижаться ниже, 3г на 1кг сухой массы.

2. Соблюдать необходимую калорийность рациона.

3. Снизить объемы и интенсивность тренировок. Желательны тренировки малой повторности и интенсивности с большими весами.

4. Исключить аэробику из курса тренировок.

5. Стараться избегать стрессовых ситуаций и недосыпаний.

6. Потреблять не менее 10-20г глютамина в день.

Но это конечно еще не все, нам пригодятся антикатаболики. А именно метандростенолон. Не обращайте внимания на тот факт, что данный препарат подавляет производство эндогенного тестостерона, что также могут делать некоторые стероиды. Ведь если его принимать в утреннее время, не позже часа дня, то риск проявления данного недуга сходит практически на нет.

Хорошей заменой метану может стать инсулин, так же не слабый антикатаболик. Инсулин можно принимать по любой схеме, но лучше всего принимать его каждый день, разделив дозу на два раза.

Все препараты указанные мною выше не обладают способностью блокировать рецепторы кортизола. Для понижения уровня данного гормона понадобиться фосфатидилсерин, а не препарат гонадотропин. Постоянный прием данного препарата, в дозировке от 800 до 1200 мг в день, способствует снижению уровня кортизола практически на 50%. Так же в курс можно включить витамин C, в небольших дозировках.

Обеспечение нормального тренировочного процесса

Для подавления депрессии и для набора мотивации к тренировочному процессу, нам опять-таки пригодится инсулин, часто попадающий в стероидный курс. Данный препарат способствует нормализации психического состояния.

Так же инсулин, частый гость стероидного курса, в ответе за быстро накопление гликогена, что позволяет в нормальном режиме восстанавливаться после изнурительных тренировок.

Нормализация уровня эстродиола

Здесь существует два подхода, первый – блокировать рецепторы эстрогенов, на что способны некоторые стероиды, второй – снизить уровень ароматазы в периферических тканях. С первой задачей неплохо справляются кломид и тамоксифен. Для решения второй нам понадобится провирон. Именно эти препараты, используемые после курса стероидов, помогут вас с нормализацией уровня эстродиола.

Нормализация уровня пролактина

Уменьшить уровень вырабатываемого пролактина лучше всего получается у бромокриптина. Он же способствует повышению секреции ГР – гормона роста и лептина (гормон сытости и либидо). Плюс ко всему данный препарат, не имеющий ничего общего со стероидами, зарекомендовал себя в качестве неплохого жиросжигателя.

Но и это еще не все, бромокриптин после курса стероидов неплохо борется с развитием гинекомастии, вызванной препаратами с прогестагенной активностью.

Период полураспада бромокриптина находится в районе 12 часов. Исходя из этого факта, принимать бромокриптин необходимо по две с половиной таблетки (2.5г) утром и вечером.

Восстановление производства эндогенного тестостерона

Опять же для решения данной задачи нам пригодятся кломид и тамоксифен. Я уже описывал все позитивные стороны обоих препаратов, как и их недостатки, так что выбор препарата я оставляю на ваше усмотрение. Об этом можно почитать в статье “Кломид против Тамоксифена”.

Отмечу лишь наиболее значимые недостатки. К таковым относится способность кломида повышать уровень ГСПГ, на что также способны стероиды, и снижения уровня синтезируемого ИФР-1 при применении тамоксифена.

Если же не один из этих препаратов, не стероидов, вам по каким-либо причинам не подходит, попробуйте воспользоваться препаратом под названием трибулус террестрис, в сочетании с цинком в объеме 100 мг в сутки.

Снижение уровня ГСПГ и где купить гормон гонадотропин

Снижение ГСПГ не менее важная задача, чем нормализация синтеза тестостерона и восстановление после курса стероидов. Т.к. именно с повышением ГСПГ связана эффективность андрогенных анаболических стероидов под конец цикла. А с учетом того факта что повышенный уровень ГСПГ довольно-таки долго сохраняется в организме, можно сделать вывод что без принятия существенных мер нам не обойтись. Лучше всего на роль борца с повышенным уровнем ГСПГ подходит все тот же инсулин и провирон. Так же можно воспользоваться местеролоном.

Согласно исследованиям 1989 года, оральный станозолол, как и некоторые другие стероиды, понижает уровень секреции глобулина, уменьшая тем самым уровень ГСПГ приблизительно на 50%. Данный препарат лучше всего принимать в промежутке между курсами, циклами вместо метана.

Мы рассмотрели все задачи требующие решения и обнаружили, что решить каждую из них можно как минимум двумя способами. Применение гонадотропина важно, но есть и другие средства, которые окажут атлету непосильную помощь. Здесь необходимо понимать, какие препараты и для каких случаев подходят лучше всего.

И самое главное: если необходим гормон гонадотропин , то лучшие препараты можно найти в нашем интернет-магазине. Здесь Вы также найдете большой ассортимент другой актуальной в спорте фармакологии, – от пептидов до новых препаратов генного допинга.

По материалам: AthleticPharma.com

Гонадотропин, Гонадотропин хорионический, ХГЧ — является гормональным препаратом, применяется как мужчинами, так и женщинами, цель применения у мужчин: для стимуляции синтеза половых гормонов в наших яичках (тестикулах, гонадах), развития половых органов, а также вторичных половых признаков.

ХГЧ биологически схож с Лютеинизирующим гормоном, при экзогенном поступлении в организм, гипофиз, принимая сигнал, заставляет яички вырабатывать . Уловили смысл? Отлично, значит гонадотропин хорионический позволяет нам повысить наш уровень тестостерона.

А теперь проще — когда мы находимся на курсе стероидов, не важно какой мы принимает стероид, наш организм перестает вырабатывать собственный тестостерон, получается, что яички перестают работать как следует, в следствии возникает атрофия яичек.

Да, часто, когда вы получаете данную информацию, вы говорите: зачем тогда анаболические стероиды, если есть гонадотропин?

Ставить анаболические стероиды более безопаснее, чем ХГЧ, потому как для достижения высокого уровня тестостерона, необходимо ставить огромные дозировки в неделю, порядка 5000 ЕД в неделю, что чревато последствиями

И вот тут возникает собственно вопрос: как и когда, и сколько колоть гонадотропин?

Я, как сторонник небольших дозировок говорю: есть несколько схем приема ХГЧ , разберем их:

1. Прочитав огромное количество научной литературы по данной теме (сейчас говорю про зарубежные источники) на западе, частая схема приема выглядит следующим образом:

Начиная со второй недели, они ставят по 500 ЕД каждую неделю до конца использования курса анаболических стероидов, либо по 250 ЕД дважды в неделю.

2. Ставить гонадотропин с третей недели курса по схеме 3-4-5 недели курса по 1000 ЕД каждую неделю, после перерыв 2-3 недели, далее схема повторяется, кстати, гонадотропин ставится при условии, что курс более шести недель .

3. Более распространенная схема, но в то же время устаревшая: используют гонадотропин на последних неделях курса , например, если курс 12 недель, то ставят ХГЧ начина с 8-ой недели по 1500 ЕД в неделю, до начала ПКТ.

Длительное применение ХГЧ не имеет смысла, так как в ответ на экзогенное поступление, организм начинает вырабатывать антитела.

В следующей части статьи я расскажу, как применяют ХГЧ зарубежные спортсмены, так как я знаком с одним парнем из США (выходец из Беларуси), который выступает в менс физик, смотрю его стримы, общаюсь лично через социальные сети, посещаю его вебинары, так же отвечу на вопрос: используют ли гонадотропин на ПКТ (послекурсовой терапии).

Обнаружение экспрессии мРНК гонадотропин-рилизинг-гормона и его рецептора в нормальной и неопластической предстательной железе крыс

Гипоталамический гонадотропин-рилизинг-гормон (ГнРГ) играет центральную роль в регуляции репродуктивной системы млекопитающих как высвобождающий гормон гонадотропинов гипофиза. Однако ряд исследований показал, что GnRH или его рецептор также экспрессируются в некоторых репродуктивных органах, включая предстательную железу, молочную железу, яичник и плаценту, опухоли и линии опухолевых клеток, происходящие из этих органов, что позволяет предположить, что этот пептидный гормон может иметь другие внегипофизарные действует в дополнение к своей роли гонадотропин-рилизинг-гормона.Более того, было продемонстрировано, что аналоги GnRH оказывают некоторое прямое ингибирующее действие на пролиферацию клеток рака простаты человека и крысы, вероятно, опосредованное собственными специфическими рецепторами, экспрессируемыми в этих опухолевых клетках. В настоящем исследовании мы исследовали экспрессию мРНК GnRH и его рецептора в нормальной предстательной железе благородных крыс и на трех моделях рака простаты крыс, включая индуцированную половыми гормонами модель благородных крыс, андроген-независимую опухоль предстательной железы благородных крыс (AIT). ) и аденокарциномы предстательной железы крыс Даннинга с помощью ОТ-ПЦР и Саузерн-блоттинга.Результаты показали, что мРНК GnRH экспрессировалась в нормальной, обработанной гормонами и неопластической предстательной железе крысы, в дополнение к ее положительной контрольной экспрессии в гипоталамусе, тогда как ее рецептор был обнаружен только в андроген-зависимой опухоли Dunning R3327H. Обнаружение как GnRH, так и его рецептора в андроген-зависимой опухолевой ткани Dunning R3327H предполагает, что этот пептидный гормон может иметь некоторые аутокринные и паракринные регуляторные функции в этой опухоли. Однако экспрессия гена рецептора GnRH не была обнаружена в двух андрогеннезависимых сублиниях опухолей Даннинга и в опухоли предстательной железы Noble крыс, AIT, что позволяет предположить, что экспрессия рецептора GnRH теряется или подавляется в опухолях простаты во время прогрессирования до гормононезависимый фенотип.

Повышенный риск пневмонии у пациентов, получающих агонисты гонадотропин-высвобождающего гормона при раке простаты

Аннотация

Фон

Это исследование было направлено на изучение взаимосвязи между использованием агонистов гонадотропин-рилизинг-гормона (ГнРГ) и последующим риском пневмонии у пациентов с раком простаты (РПЖ) с использованием популяционного набора данных.

Методы

Мы получили данные из Тайваньской базы данных долгосрочного медицинского страхования за 2000 год.Мы включили в это исследование 2064 ПК. Из отобранных пациентов с ПК 1207 получали лечение агонистами гонадолиберина. Мы индивидуально отслеживали каждого пациента ПК в течение 1 года, чтобы определить тех, кто был госпитализирован с пневмонией. Мы выполнили регрессию пропорционального риска Кокса, чтобы изучить связь между использованием агонистов ГнРГ и риском пневмонии в течение 1-летнего периода наблюдения.

Результаты

Заболеваемость пневмонией в течение 1 года наблюдения составила 4.35 (95% доверительный интервал (ДИ): 1,89 ~ 9,64) на 100 человеко-лет и 2,14 (95% ДИ: 1,31 ~ 3,32) на 100 человеко-лет для пациентов с РПЖ, которые получали и тех, кто не получал лечение агонистами ГнРГ , соответственно. Лог-ранговый тест показал, что существует значительная разница в годичной выживаемости без пневмонии между пациентами с РПЖ, которые лечились, и теми, кто не получал лечение агонистами ГнРГ ( p <0,002). После поправки на возраст, ежемесячный доход и индекс сопутствующих заболеваний Чарлсона пациенты с РПЖ, получавшие лечение агонистами ГнРГ, с большей вероятностью были госпитализированы по поводу пневмонии в течение 1-летнего периода наблюдения, чем пациенты с РПЖ, которые не получали лечения с помощью Агонисты ГнРГ (степень опасности: 1.92, 95% ДИ: 1,10 ~ 3,36).

Выводы

пациентов с РС, получавших лечение агонистами ГнРГ, имели повышенный риск пневмонии.

Образец цитирования: Chung S-D, Liu S.-P, Lin H-C, Wang L-H (2014) Повышенный риск пневмонии у пациентов, получающих агонисты гонадотропин-высвобождающего гормона при раке простаты. PLoS ONE 9 (6): e101254. https://doi.org/10.1371/journal.pone.0101254

Редактор: Чи-Пин Чуу, Национальные научно-исследовательские институты здравоохранения, Тайвань

Поступила: 1 апреля 2014 г .; Одобрена: 4 июня 2014 г .; Опубликован: 27 июня 2014 г.

Авторские права: © 2014 Chung et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Авторы подтверждают, что все данные, лежащие в основе выводов, полностью доступны без ограничений. Это исследование основано на обезличенных вторичных данных LHID2000, выпущенных Тайваньским национальным научно-исследовательским институтом здравоохранения (NHRI) без ограничений для исследовательских целей.LHID2000, открытый для исследователей, был доступен в Национальном правозащитном учреждении (http://nhird.nhri.org.tw/date_01.html). Исследователи могли отправлять запросы в NHRI для доступа к данным LHID2000.

Финансирование: У авторов нет поддержки или финансирования, чтобы сообщить.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Рак предстательной железы (РП) был вторым по частоте диагностированием рака и шестым по значимости причиной смерти от рака среди мужчин во всем мире в 2011 году [1].В 2012 году в Европе это было 3-е место среди наиболее диагностируемых онкологических заболеваний после рака груди и колоректального рака с 417 000 случаев [2]. ПК может вызывать боль, затрудненное мочеиспускание, проблемы во время полового акта и эректильную дисфункцию [3]. Андрогенная депривационная терапия (ADT), включая орхидэктомию, эстрогены, агонисты лютеинизирующего гормона (LHRH), антиандрогены, а также агонисты и антагонисты рецепторов гонадотропин-рилизинг-гормона (GnRH), является стандартным лечением PC [4]. В частности, агонисты GnRH наиболее широко используются для лечения PC.

Агонисты

GnRH вызывают обратимый гипогонадизм и снижают уровни андрогенов в сыворотке, включая уровни тестостерона и дигидротестостерона (DHT) [5]. Несколько исследований показали, что половые стероидные гормоны участвуют в коммуникации между микроорганизмами и млекопитающими-хозяевами [6]. Воздействие половых стероидных гормонов на заболевания, вызываемые бактериями, зависит от инфекционных видов и уровней гормонов. В целом, самцы многих видов более восприимчивы, чем самки, к инфекциям, вызываемым паразитами, грибами, бактериями и вирусами.Одной из основных причин половых различий в инфекции являются различия в эндокринно-иммунных взаимодействиях [7]. Андроген поддерживает пониженную экспрессию ключевых элементов врожденного иммунитета и снижает антибактериальную способность. В исследовании на животных Quintar et al. обнаружили зависящее от времени повышение уровня антибактериального вещества β-дефенсинов (rBD-1) и сурфактантного белка D (SP-D) в течение 3–7 дней после орхиэктомии [8]. Однако агонисты ГнРГ необходимо использовать в течение длительного времени для лечения ПК. До сих пор остается неясным, увеличивает ли длительное использование агонистов ГнРГ последующий риск инфицирования.Насколько нам известно, в предыдущих исследованиях не предпринималось попыток оценить влияние использования агонистов ГнРГ на риск заражения. Поэтому, чтобы восполнить этот пробел в наших знаниях, мы изучили взаимосвязь между использованием агонистов ГнРГ и последующим риском пневмонии у пациентов с ПК, используя популяционный набор данных из Тайваня и ретроспективный когортный дизайн.

Методы

База данных

В этом ретроспективном когортном исследовании использовались данные, полученные из базы данных долгосрочного медицинского страхования (LHID2000).LHID2000, составленный Тайваньским национальным научно-исследовательским институтом здравоохранения (NHRI), включает данные о медицинских заявлениях и файлы реестра для 1000000 человек, случайно выбранных из всех участников программы Тайваньского национального медицинского страхования (NHI) в 2000 году ( n = 23,72 миллиона). . LHID2000, открытый для тайваньских исследователей, был доступен в Национальном правозащитном учреждении по правам человека (http://nhird.nhri.org.tw/date_01.html). Это исследование основано на обезличенных вторичных данных из LHID2000, выпущенных Национальным правозащитным учреждением по правам человека без ограничений для исследовательских целей.Сотни исследователей использовали этот набор данных для проведения и публикации исследований [9]. LHID2000 предоставляет исследователям прекрасную возможность отследить использование всех медицинских услуг для этих 1 000 000 бенефициаров с момента запуска программы NHI в 1995 году. Это исследование не подлежало полному рассмотрению Советом по институциональному обзору, поскольку LHID2000 состоит из деидентифицированных вторичных данные, предоставленные общественности в исследовательских целях.

Образец исследования

Сначала мы отобрали всех пациентов, которым впервые был поставлен основной диагноз ПК (код 185 МКБ-9-CM, злокачественное новообразование простаты) при амбулаторном приеме (включая амбулаторные отделения больниц и клиник) или во время госпитализации из С 1 января 2001 г. по 31 декабря 2010 г. ( n = 2136).Мы исключили пациентов в возрасте до 40 лет из-за очень низкой распространенности ПК в этой возрастной группе ( n = 63). Мы также исключили пациентов, которым была сделана орхиэктомия в течение 1-летнего периода наблюдения ( n = 9). В результате в это исследование были включены 2064 пациента с ПК. Из отобранных пациентов с РПЖ 1207 (58,5%) получали лечение агонистами ГнРГ в течение более 1 месяца после даты индексации. Для пациентов с ПК, которые не получали агонисты ГнРГ, мы назначили дату получения их первого диагноза ПК в качестве даты индекса.Однако для пациентов с РПЖ, получавших лечение агонистами ГнРГ, мы определили первое посещение амбулаторной помощи для лечения агонистами ГнРГ как дату индекса.

В этом исследовании мы индивидуально отслеживали каждого пациента ПК в течение 1 года, чтобы определить тех, кто был госпитализирован с основным диагнозом пневмонии (коды МКБ-9-CM 480 ~ 483,8, 485 ~ 486 и 487,0), начиная с от даты их индекса. В этом исследовании также была проведена цензура случаев смерти людей по причинам, не связанным с пневмонией, в течение 1-летнего периода наблюдения (124 пациента умерли, в том числе 96 пациентов, получавших лечение агонистами гонадолиберина, и 28 — нет).

Статистический анализ

Мы использовали статистический пакет SAS (Институт SAS, Кэри, Северная Каролина) для выполнения всех статистических анализов. Мы провели тесты Pearson χ 2 и t для сравнения различий между пациентами с РПЖ, которые проходили лечение агонистами ГнРГ, и теми, кто не получал лечение агонистами ГнРГ, с точки зрения социально-демографических характеристик (возраст, ежемесячный доход, уровень урбанизации и географическое положение). места жительства пациента (северный, центральный, восточный и южный Тайвань).Эти состояния учитывались только в том случае, если они возникли либо во время госпитализации, либо в двух или более заявках на амбулаторную помощь, закодированных за 6 месяцев до и после индексного посещения амбулаторной помощи.

Мы также рассчитали 1-летнюю выживаемость без пневмонии с помощью метода Каплана-Мейера и использовали лог-ранговый тест для исследования риска пневмонии у пациентов, которые проходили лечение, и тех, кто не получал лечение агонистами ГнРГ. Мы также выполнили пропорциональную регрессию рисков Кокса, цензурируя случаи смерти людей от причин, не связанных с пневмонией, в течение 1-летнего периода наблюдения и корректируя социально-демографические характеристики и индекс сопутствующих заболеваний Чарлсона (CCI), чтобы исследовать связь между использование агонистов ГнРГ и риск пневмонии в течение 1-летнего периода наблюдения.Мы использовали двустороннее значение p 0,05 для определения значимости в этом исследовании.

Результаты

Распределение демографических характеристик и баллов по шкале CCI для выбранных пациентов представлено в таблице 1. Наблюдалась статистически значимая разница в среднем возрасте (74,2 против 71,9 года, p <0,001) и месячном доходе ( p <0,001) между пациентами, получавшими РПЖ, и теми, кто не получал лечение агонистами ГнРГ. Кроме того, наблюдалась статистически значимая разница в распределении баллов CCI между этими двумя группами.Пациенты, получавшие лечение агонистами ГнРГ, с большей вероятностью имели показатель CCI ≥4, чем пациенты, не получавшие лечения агонистами ГнРГ ( p <0,001). Однако не было значительных различий в уровне урбанизации, географическом положении, диабете, гипертонии и ишемической болезни сердца между пациентами с PC, которые проходили лечение, и теми, кто не получал лечение агонистами GnRH.

Таблица 2 показывает заболеваемость пневмонией в течение 1-летнего периода наблюдения среди пациентов, которые проходили лечение, и тех, кто не получал лечение агонистами гонадолиберина.В общей выборке из 2064 пациентов с РП заболеваемость пневмонией в течение 1-летнего периода наблюдения составила 3,65 (95% доверительный интервал (ДИ): 2,88 ~ 4,56) на 100 человеко-лет. Показатели заболеваемости пневмонией в течение 1-летнего периода наблюдения составили 4,35 (95% ДИ: 1,89 ~ 9,64) на 100 человеко-лет и 2,14 (95% ДИ: 1,31 ~ 3,32) на 100 человеко-лет для пациентов с РПЖ. и те, кто не получал лечения агонистами ГнРГ, соответственно. Кроме того, лог-ранговый тест показал, что существует значительная разница в годовой выживаемости без пневмонии между пациентами с РПЖ, которые проходили лечение, и теми, кто не получал лечения агонистами ГнРГ ( p <0.002).

В таблице 2 также показаны приблизительные и скорректированные отношения рисков (HR) для пневмонии между пациентами с РПЖ, которые проходили лечение, и теми, кто не получал лечения агонистами ГнРГ. Регрессия пропорционального риска Кокса показала, что HR пневмонии для пациентов с РПЖ, получавших лечение агонистами ГнРГ в течение 1-летнего периода наблюдения, составлял 2,23 (95% ДИ: 1,30 ~ 3,82) по сравнению с пациентами с РПЖ, которые не получали лечения с помощью Агонисты ГнРГ после цензуры случаев смерти по причинам, не связанным с пневмонией, в течение 1-летнего периода наблюдения.Кроме того, после цензуры случаев смерти от причин, не связанных с пневмонией, и поправки на возраст, ежемесячный доход и показатель CCI, пациенты с РПЖ, получавшие лечение агонистами гонадолиберина, с большей вероятностью были госпитализированы для лечения пневмонии в течение 1 года наблюдения. период увеличения, чем у пациентов с РПЖ, которые не получали лечения агонистами ГнРГ (ОР: 1,92, 95% ДИ: 1,10–3,36).

Обсуждение

Насколько нам известно, это первое исследование, в котором сообщается, что существует значительная взаимосвязь между использованием агонистов ГнРГ и повышенным риском пневмонии у пациентов с ПК.Регрессия пропорционального риска Кокса показала, что скорректированный HR пневмонии в течение 1-летнего периода наблюдения для пациентов с РПЖ, получавших лечение агонистами ГнРГ, составлял 2,23 (95% ДИ: 1,30 ~ 3,82) по сравнению с пациентами с РПЖ, которые не получали лечения. с агонистами гонадолиберина.

Мы предлагаем четыре возможных объяснения ассоциации, обнаруженной в этом исследовании. Во-первых, агонисты ГнРГ вызывают обратимый гипогонадизм и снижают уровень андрогенов в сыворотке. Дефицит андрогенов может вызывать морфологические и биохимические изменения в легких.В исследованиях Ojeda et al. [10], [11] они обнаружили значительные морфологические изменения паренхимы легких у хирургически кастрированных крыс по сравнению с контрольной группой, аналогичные наблюдаемым при эмфиземе легких человека. Используя световую микроскопию, очевидная гипертрофия интерстициальной ткани была связана с увеличением количества соединительных волокон и макрофагальной инвазией. Подавление андрогенов хирургическими или фармакологическими методами вызывает значительные изменения химического состава клеточных мембран и сурфактантов легких.Во-вторых, андроген-индуцированные изменения в чувствительности к антибиотикам и росте микробов в Plotkin et al. исследование [12]. Воздействие как тестостерона, так и ДГТ привело к восьмикратному увеличению чувствительности P. aeruginosa к тобрамицину, а также значительно замедлило его рост. В-третьих, при андрогенной недостаточности состав микрофлоры желудочно-кишечного тракта может измениться на основных представителей патогенной флоры. Косырева продемонстрировала изменение качественного и количественного состава микрофлоры просвета толстой кишки на 52-е сутки после хирургической кастрации у крыс Вистар, что сопровождалось увеличением количества условно-патогенных бактерий [13].Наконец, андроген может увеличить выработку нейтрофилов. Chuang et al. собирали количество клеток крови у 33 пациентов с запущенным раком простаты до и после хирургической кастрации [14]. Результаты показали, что дифференциальное количество нейтрофилов у этих пациентов с РПЖ умеренно снизилось после хирургической кастрационной терапии. Кроме того, они также доказали, что экзогенный андроген может восстанавливать количество нейтрофилов у кастрированных мышей. По указанным выше причинам мы прогнозируем, что пациенты с PC, получающие агонисты GnRH, будут иметь повышенный риск инфицирования из-за состояния дефицита андрогенов.

Это исследование имеет несколько сильных сторон. Во-первых, большая база данных, вероятно, будет репрезентативной для населения страны и даст хорошую возможность изучить связь между агонистами гонадолиберина и пневмонией. Во-вторых, мы учли потенциальные факторы риска пневмонии в регрессионных моделях. К ним относятся возраст, ежемесячный доход, уровень урбанизации и географическое местоположение пациента, а также CCI. Наконец, мы оценили причины госпитализации больных ПК.Путем цензуры случаев смерти по причинам, не связанным с пневмонией, и корректировки по возрасту, ежемесячному доходу и баллу CCI, мы обнаружили, что пациенты с PC, которые получали лечение агонистами GnRH, с большей вероятностью были госпитализированы для лечения пневмонии в течение следующего года. период увеличения по сравнению с пациентами с ПК, не получавшими лечения агонистами гонадолиберина. Это неизменно указывает на то, что пациенты с ПК, получающие агонисты ГнРГ, могут иметь повышенный риск пневмонии.

У данного исследования есть несколько ограничений, которые заслуживают особого внимания.Во-первых, поскольку мы идентифицировали пациентов с пневмонией, получающих агонисты ГнРГ после даты индексации LHID2000, данные не позволили нам узнать патогенные бактерии в крови пациента или различия в степени тяжести пневмонии. Поэтому мы не могли оценить, какой возбудитель вызвал пневмонию. Во-вторых, данные LHID2000 не содержат информации об индексе массы тела пациентов, привычках к курению, потреблению алкоголя, физической активности, стадии заболевания, времени приема гонадолиберин или лекарств, отпускаемых без рецепта.Поэтому мы не могли оценить влияние этих факторов на пневмонию. В-третьих, наши результаты показывают, что пациенты, получавшие лечение агонистами ГнРГ, с большей вероятностью имели показатель CCI ≥4, чем пациенты, которые не получали лечение агонистами ГнРГ. Поскольку пневмония распространена среди пациентов низшего ранга с тяжелыми сопутствующими заболеваниями, причинно-следственная связь ADT и пневмонии не может быть легко установлена ​​в настоящем исследовании.

Результаты этого исследования показывают, что пациенты с PC, получающие лечение агонистами GnRH, могут иметь повышенный риск пневмонии после корректировки на сопутствующие соматические расстройства.Хотя механизм настоящего открытия все еще неясен, врачи должны знать об этой связи, когда они назначают агонисты ГнРГ в клинических условиях. Рекомендуется дальнейшее исследование, чтобы подтвердить наши выводы и изучить лежащий в основе патомеханизм.

Вклад авторов

Задумал и спроектировал эксперименты: LHW SPL HCL SDC. Проанализированы данные: LHW HCL. Участвовал в написании рукописи: LHW SPL HCL SDC. Критическая ревизия: LHW HCL SDC.

Ссылки

  1. 1.Джемал А., Брей Ф. (2011) Центр М.М., Ферли Дж., Уорд Э., Форман Д. (2011) Глобальная статистика рака. CA. Рак J Clin 61: 69–90.
  2. 2. Ферлей Дж., Стелиарова-Фуше Э., Лорте-Тьелент Дж., Россо С., Коберг Дж. В. и др. (2012) Заболеваемость раком и структура смертности в Европе: оценки для 40 стран в 2012 году. Eur J Cancer 49: 1374–1403.
  3. 3. Nelson WG, De Marzo AM, Isaacs WB (2003) Рак простаты. N Engl J Med 349: 366–81.
  4. 4. Schröder F, Crawford ED, Axcrona K, Payne H, Keane TE (2012) Андрогенная депривационная терапия: прошлое, настоящее и будущее.BJU International 109: 1–12.
  5. 5. Labrie F, Bélanger A, Luu-The V (2005) Агонисты гонадотропин-высвобождающего гормона при лечении рака простаты. Endocr Rev 26: 361–79.
  6. 6. Гарсиа-Гомес Э., Гонсалес-Педрахо Б., Камачо-Арройо I (2013) Роль половых стероидных гормонов во взаимодействиях бактерий-хозяин. Биомед. Res Int Код статьи 928290.
  7. 7. Klein SL (2000) Влияние гормонов на половые различия при инфекции: от генов к поведению.Neurosci Biobehav Rev 24: 627–638.
  8. 8. Quintar A A, Leimgruber C, Pessah O A, Doll A, Maldonado CA (2012) Истощение запасов андрогенов усиливает антибактериальную защиту простаты у крыс. Инт. Дж. Андрол 35: 845–859.
  9. 9. Chen YC, Yeh HY, Wu JC, Haschler I, Chen TJ, Wetter T (2011) Национальная база данных исследований в области медицинского страхования Тайваня: административная база данных по здравоохранению как объект исследования в библиометрии. Наукометрия 86: 365–380.
  10. 10. Ojeda MS, Scardapane EGL, Gimenez MS (2003) Морфологические и биохимические изменения в легких самцов крыс после хирургической и фармакологической кастрации.Braz J Med Biol Res 33: 279–285.
  11. 11. Ojeda MS, Gomez N, Gimenez MS (1997) Андрогенная регуляция липидов легких у самцов крыс. Липиды 32: 57–62.
  12. 12. Плоткин Б.Дж., Руз Р.Дж., Эриксон К., Визелли С.М. (2003) Влияние андрогенов и глюкокортикоидов на рост микробов и чувствительность к антимикробным препаратам. Curr Microbiol 47: 514–520.
  13. 13. Косырева А.М. (2013) Гистофизиология иммунной системы и барьерных органов в позднем периоде орхиэктомии у крыс линии Вистар.Булл Эксп Биол Мед 154: 480–484.
  14. 14. Chuang KH, Altuwaijri S, Li G (2009) Нейтропения с нарушенной защитой хозяина от микробной инфекции у мышей, лишенных рецептора андрогенов. J Exp Med 206: 1181–1199.

Влияние антагониста гонадотропин-высвобождающего гормона на риск совершения сексуального насилия над детьми у мужчин с педофильным расстройством: рандомизированное клиническое испытание | Психиатрия и поведенческое здоровье | JAMA Psychiatry

Ключевые моменты

Вопрос Может ли антагонист гонадотропин-рилизинг-гормона быстро снизить риск совершения сексуального насилия над детьми у мужчин с педофильным расстройством, которые обращаются за помощью?

Выводы В этом рандомизированном клиническом исследовании 52 мужчин с педофильным расстройством лечение дегареликсом статистически значимо снижало риск совершения сексуального насилия над детьми через 2 недели после первоначальной инъекции.

Значение Это открытие свидетельствует о том, что дегареликс может служить быстродействующим лекарством, снижающим риск, для мужчин с педофильным расстройством.

Важность Отсутствуют доказательные методы лечения педофильного расстройства, полученные в ходе рандомизированных клинических испытаний.

Объектив Определить, снижает ли антагонист гонадотропин-рилизинг-гормона динамические факторы риска совершения сексуального насилия над детьми.

Дизайн, обстановка и участники Это академически инициированное двойное слепое плацебо-контролируемое рандомизированное клиническое исследование фазы 2 в параллельных группах было проведено в центре ANOVA в Стокгольме, Швеция, с 1 марта 2016 г. по 30 апреля 2019 г. Лица, обратившиеся в PrevenTell, набиралась национальная телефонная линия помощи по нежелательной сексуальности. Подходящими участниками были мужчины в возрасте от 18 до 66 лет, обратившиеся за помощью, с диагнозом педофилическое расстройство и без противопоказаний к вмешательству.Первичная конечная точка оценивалась анализом намерения лечить.

Вмешательства Рандомизация для получения либо 2 подкожных инъекций по 120 мг дегареликса ацетата, либо равного объема плацебо.

Основные результаты и мероприятия Первичной конечной точкой было среднее изменение между исходным уровнем и 2 неделями в совокупной оценке риска по 5 областям сексуального насилия над детьми в диапазоне от 0 до 15 баллов; каждый домен может быть оценен от 0 до 3 баллов.Вторичные конечные точки включали эффективность через 2 и 10 недель, измеренную по совокупной шкале, каждой области риска, качеству жизни, самооценкам эффектов и побочным эффектам.

Результаты В общей сложности 52 участника мужского пола (средний возраст [SD], 36 [12] лет) были рандомизированы для получения либо дегареликса (n = 25; при 1 отмене), либо плацебо (n = 26). Через 2 недели общий балл риска снизился с 7,4 до 4,4 для участников в группе дегареликса и с 7,8 до 6,6 для группы плацебо, средняя разница между группами составила -1.8 (95% ДИ, от –3,2 до –0,5; P = 0,01). Снижение было отмечено в сводном балле через 10 недель (-2,2 [95% ДИ, от -3,6 до -0,7]), а также в областях педофильного расстройства (2 недели: -0,7 [95% ДИ, -1,4 до 0,0]. ]; 10 недель: -1,1 [95% ДИ, от -1,8 до -0,4]) и озабоченность сексом (2 недели: -0,7 [95% ДИ, от -1,2 до -0,3]; 10 недель: -0,8 [95% ДИ, От -1,3 до -0,3]) в группе дегареликса по сравнению с группой плацебо. Никаких различий не наблюдалось для областей самооценки риска (2 недели: -0,4 [95% ДИ, -0.9 до 0,1]; 10 недель: –0,5 [95% ДИ, –1–0]), низкая эмпатия (2 недели: 0,2 [95% ДИ, –0,3–0,6]; 10 недель: 0,2 [95% ДИ, –0,2–0,6]) , и нарушение саморегуляции (2 недели: -0,0 [95% ДИ, от -0,7 до 0,6]; 10 недель: 0,1 [95% ДИ, от -0,5 до 0,8]) или качества жизни (индексный балл опросника EuroQol 5 Dimensions , 2 недели: 0,06 [95% ДИ, от –0,00 до 0,12] и 10 недель: 0,04; 95% ДИ, от –0,02 до 0,10; визуальная аналоговая шкала EuroQol, 2 недели: 0,6 [95% ДИ, от –9,7 до 10,9] и 10 недель: 4,2 [95% ДИ, от –6,0 до 14,4]). Две госпитализации произошли из-за обострения суицидальных мыслей, а также больше реакций в месте инъекции (дегареликс: 22 из 25 [88%]; плацебо: 1 из 26 [4%]) и повышение уровня гепатобилиарных ферментов были зарегистрированы участниками, которые принимали дегареликс (дегареликс: 11 из 25 [44%]; плацебо: 2 из 26 [8%]).Среди 26 участников, рандомизированных для приема дегареликса, 20 (77%) испытали положительное влияние (например, улучшение отношения или поведения) на сексуальность, а 23 (89%) сообщили о побочных эффектах на организм.

Заключение и актуальность Это исследование показало, что дегареликс снижает оценку риска совершения сексуального насилия над детьми у мужчин с педофильным расстройством через 2 недели после первоначальной инъекции, что предполагает использование препарата в качестве варианта лечения с быстрым началом. Необходимы дальнейшие исследования эффектов и долгосрочных побочных эффектов гормональной недостаточности.

Регистрация пробной Идентификационный номер реестра клинических испытаний ЕС: 2014-000647-32

Сексуальное насилие над детьми затрагивает каждую пятую девочку и каждого десятого мальчика во всем мире. 1 Сопровождается неблагоприятным психосоциальным исходом на протяжении всей жизни. 1 , 2 Профилактические меры были рекомендованы, 3 , но на сегодняшний день данные о вмешательстве ограничены. 4 , 5

По оценкам, доля привлеченных к уголовной ответственности несовершеннолетних преступников, совершивших сексуальные преступления, составляет 1%. 1 , 4 Из тех, кто подвергся судебному преследованию, до 95% были впервые правонарушителями 6 , и половина из них страдала педофильным расстройством, 7 определялось как повторяющееся сексуальное влечение к детям препубертатного возраста, связанное с дистрессом или негативными последствиями . Исследования показали, что не все мужчины с педофильным расстройством совершают сексуальное преступление, но те, кто это делают, обычно сообщают, что боролись со своими сексуальными влечениями в течение 10 лет, прежде чем совершить сексуальное преступление. 6 , 8 Следовательно, существует возможность профилактики при лечении лиц из группы высокого риска без предварительного осуждения.Эффективное лечение может предотвратить сексуальное насилие над детьми и снизить психосоциальный стресс для человека с педофильным расстройством.

В настоящее время рекомендуемые вмешательства включают психотерапию и антидепрессанты, а также препараты, подавляющие тестостерон, для лиц с высоким риском. 9 Мнения о лечении резкие. Во многих странах для химической кастрации требуется процедура информированного согласия. Тем не менее, химическая кастрация используется в качестве обязательного юридического наказания для несовершеннолетних преступников, совершивших сексуальные преступления в некоторых юрисдикциях в США, Азии и Европе, но запрещена в других странах из-за этических соображений принуждения и неопределенной эффективности. 10 , 11

Поскольку они снижают уровень тестостерона за счет десенсибилизации рецепторов, агонисты гонадотропин-рилизинг-гормона считаются эффективными в уменьшении симптомов парафилии. 12 Однако использование этих агонистов ограничено контролируемыми исправительными учреждениями из-за отсутствия рандомизированных клинических испытаний; их метаболические побочные эффекты; и начальное повышение уровня тестостерона, которое может быть связано с повышенной агрессией и либидо, что требует одновременного приема антиандрогенных препаратов. 9 Опыт шведской горячей линии PrevenTell свидетельствует о необходимости как краткосрочного краткосрочного лечения (например, в критических фазах расстройства, чтобы быстро контролировать сексуальные импульсы или уменьшить высокую степень борьбы), так и длительного лечения. Дегареликс ацетат — антагонист гонадотропин-рилизинг-гормона, одобренный Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США в 2008 году для лечения распространенного рака простаты. Дегареликс снижает уровень тестостерона до уровня кастрации в течение 3 дней без повышения уровня тестостерона 13 ; Следовательно, препарат может служить средством быстрого начала лечения для людей, обращающихся за помощью в амбулаторных условиях. 9 , 14 , 15

Для лиц без судимости не существует проверенных мер риска. Таким образом, проект PRIOTAB («Педофилия в опасности — исследования лечения и биомаркеров»), частью которого является настоящее исследование, включал построение сводной оценки на основе предыдущих наблюдательных исследований динамических (т. Е. Потенциально изменяемых с течением времени) факторов риска. за рецидив преступления на сексуальной почве. Одним из таких факторов риска является девиантный сексуальный интерес (например, педофилическое расстройство). 16 Другими факторами являются сексуальная озабоченность, нарушение саморегуляции и низкое сочувствие. 16 Поскольку все эти 4 фактора, возможно, смягчаются подавлением тестостерона, мы полагали, что дегареликс может иметь эффект снижения риска. 17 -20 Принимая во внимание проблемы, связанные с проведением исследования в труднодоступной группе населения, а также вопросы переносимости предшествующих терапий, мы провели дополнительные интервью о самооценке опыта лечения.Мы сочли использование сексуально возбуждающих материалов и измерение реакции полового члена участников слишком навязчивым.

Мы предположили, что мужчины с педофильным расстройством, которые были рандомизированы для приема дегареликса по сравнению с плацебо, будут иметь значительное снижение риска совершения сексуального насилия над детьми через 2 недели. Кроме того, мы предположили, что дегареликс будет достаточно переноситься участниками и, следовательно, будет безопасным и эффективным вариантом лечения с быстрым началом.

Это рандомизированное клиническое исследование было одобрено Шведским центральным советом по этике и Шведским агентством по медицинским продуктам (протокол исследования в Приложении 1). Все участники подписали соглашение об информированном согласии, и после исследования им было предложено лечение. Чтобы обеспечить соблюдение надлежащей клинической практики, Karolinska Trial Alliance, исследовательский центр, поддерживающий клинические испытания, обеспечил независимый мониторинг и рекомендовал более длительный период последующего наблюдения для мониторинга безопасности вмешательства; следовательно, через 10 недель был проведен второй контрольный визит с теми же оценками результатов.Исследование проводилось без какого-либо сотрудничества с фармацевтической промышленностью. Это испытание соответствовало руководящим принципам составления сводных стандартов отчетности об испытаниях (CONSORT).

Дизайн исследования и участники

Это академически инициированное двойное слепое плацебо-контролируемое исследование фазы 2 в параллельных группах со сбалансированной рандомизацией (1: 1) было проведено в центре ANOVA, высокоспециализированном центре андрологии и сексуальной медицины в Стокгольме, Швеция, с марта. С 1 2016 г. по 30 апреля 2019 г.Испытание проводилось одновременно с исследованием случай-контроль, участники которого прошли магнитно-резонансную томографию и дополнительное тестирование в то же время и в том же месте. В центре ANOVA работает PrevenTell, национальная телефонная линия помощи для самоопределения нежелательной сексуальности, через которую набирались участники испытаний. В Швеции юридическое обязательство сообщать о подозрениях в жестоком обращении с детьми имеет приоритет над профессиональной конфиденциальностью, что может заставить людей с педофильным расстройством отказываться от обращения за помощью.Чтобы свести к минимуму компромиссы в показателях набора и обеспечить достоверность самоотчетов, мы предоставили участникам временный идентификационный номер. Этот идентификационный номер сохранял анонимность участников для экспертов по оценке (SA, CR), хотя они все еще были проинформированы об обязанности специалистов в соответствии с Законом Швеции о социальных услугах направлять властям уведомление, вызывающее обеспокоенность, когда они подозревают, что ребенок находится в больнице. риск жестокого обращения или жестокого обращения и законная возможность сообщить в полицию о подозреваемых в совершении преступлений против детей.

участников были набраны с 1 марта 2016 г. по 31 января 2019 г. Блок-схема участников на каждом этапе испытания показана на рисунке. Подходящими участниками были ищущие помощи мужчины в возрасте от 18 до 66 лет с диагнозом педофилическое расстройство, как определено в Диагностическом и статистическом руководстве по психическим расстройствам (пятое издание). Полный список критериев включения и исключения представлен в Приложении 1 к Приложению 2. Участникам, набранным через PrevenTell, были предложены транспортные расходы для ознакомительных поездок и финансовая компенсация в размере 1000 шведских крон (100 долларов США до налогообложения) после завершения исследования.

Первичной конечной точкой было среднее изменение суммарной оценки риска (диапазон 0–15 баллов) между исходным уровнем и 2 неделями после рандомизации. Общая оценка риска состояла из 5 областей: 4 эмпирически выведенных динамических фактора риска (педофильное расстройство, сексуальная озабоченность, нарушение саморегуляции и низкая эмпатия) 16 и риск самооценки, каждый из которых мог быть оценен от 0 до 3 балла (Таблица 1; Приложение 1 в Приложении 2).Каждый домен имел одинаковый вес в рейтинге. Предварительно были определены три группы риска (класс риска 1: 0-5 баллов; класс риска 2: 6-10 баллов; класс риска 3: 11-15 баллов).

Мы использовали предварительно определенный анализ для первичной конечной точки. Этот анализ включал только участников с полными данными на исходном уровне и через 2 недели после инъекции.

Анализ вторичных конечных точек не исключил никаких данных. Вторичными конечными точками были эффективность через 2 и 10 недель с точки зрения снижения совокупной оценки риска и ее 5 областей, эффективность у участников класса риска 3 (11-15 баллов), качество жизни, нежелательные явления и эффекты, о которых сообщали сами. .Качество жизни измерялось во все временные точки с использованием вопросника EuroQol 5 Dimensions (EQ-5D), который состоит из показателя состояния здоровья на основе предпочтений, конвертируемого в индексные баллы от 0 до 1 (более высокий балл указывает на лучшее состояние здоровья. ) и визуальной аналоговой шкалой EuroQol (EQ-VAS) от 0 до 100, по которой более высокие баллы представляют лучшее состояние здоровья. 27 , 28

Участникам раздали дневник исследования и проинструктировали записывать любые побочные эффекты между оценками и вызывать медсестру-исследовательницу, если они почувствовали серьезный вред от лечения.При последующем наблюдении медицинские побочные эффекты регистрировались медсестрой-исследователем с использованием ответов участников на открытые вопросы о текущем состоянии здоровья и записей в дневнике. Неблагоприятные события были задокументированы психиатром (C.R.), и все события были закодированы в соответствии с MedDRA (Медицинский словарь по вопросам регулирования лекарственных средств). 29 Самооценка опыта была собрана в структурированном интервью, включая открытые вопросы о положительных (например, улучшение отношения или поведения) и отрицательных (например, побочные эффекты) эффектах инъекции и готовности поддерживать испытанные эффекты с помощью дальнейшие инъекции.Интервью были проанализированы с использованием качественного описательного контент-анализа, как описано в электронном приложении 2 в Приложении 2. 30 Ни оценщики, ни участники не знали о рандомизации лечения во время интервью или качественного анализа.

Во время первого посещения участники прошли оценку соответствия критериям и исходные условия и получили исследуемый препарат (2 подкожные инъекции 120 мг дегареликса ацетата или равный объем плацебо).Сгенерированная компьютером последовательность с рандомизацией переставленных блоков была предоставлена ​​Karolinska Trial Alliance. Последовательность рандомизации была скрыта от одного из нас (CR и SA), который набирал и оценивал участников, а затем переносил на карточки, помещенные в последовательно пронумерованные непрозрачные конверты, хранящиеся в запираемом шкафу в диспансере и доступные только 1 независимой медсестре-исследователю, которая в Очередь проинформировала медсестру, отвечающую за прием лекарств. Подробное описание процедуры инъекции представлено в Приложении 1 в Приложении 2.За исключением медсестры-исследователя, которая отвечала за рандомизацию лечения и которая также регистрировала физические побочные эффекты, все оценщики, участвовавшие в повторной оценке результатов, не знали о назначении лечения.

Размер выборки этого испытания был определен на основе опыта аналогичных, ранее опубликованных исследований биомаркеров ответа на лечение. Мы подсчитали, что запланированный размер выборки, равный 60, даст мощность более 90% для обнаружения клинически значимой разницы в первичной конечной точке.У нас не было заранее оговоренных ожидаемых показателей отсева.

Первичная конечная точка оценивалась анализом намерения лечить с использованием двухстороннего теста с неравной дисперсией t при промежуточном анализе и через 2 недели. Чтобы сохранить общий уровень значимости теста на уровне 0,05, мы выбрали двусторонний P = 0,0294 (точное значение дано в соответствии с заранее определенным статистическим планом). 31 Участники, для которых невозможно было рассчитать изменение оценки (т. Е. Пропущенные значения для оценки риска на исходном уровне или за 2 недели), были исключены из анализа первичной конечной точки при предположении, что процесс генерирования отсутствующих данных был случайным. .Кроме того, мы оценили траектории вторичных конечных точек в 2 группах лечения на 3 посещениях, включая всех рандомизированных участников. Среднее значение числовых вторичных конечных точек оценивалось с использованием линейных моделей регрессии со случайными эффектами, включая индикатор лечения (бинарная ковариата), индикаторные переменные для 2 последующих визитов (бинарные) и 2 условия взаимодействия между индикатором лечения и 2 индикатора посещений (бинарные). Модели также включали случайный перехват для конкретного участника, который, как предполагалось, подчинялся нормальному распределению.Случайный перехват был включен, чтобы учесть потенциальную зависимость в повторных наблюдениях от каждого участника.

Мы исследовали различия во временных траекториях между группами лечения, проверяя составную гипотезу о том, что члены взаимодействия вместе равны нулю, с использованием тестов типа Вальда. Мы использовали оценки моделей для оценки среднего числовых конечных точек. SE, использованные для расчета их доверительных интервалов, были получены дельта-методом.Все статистические анализы были выполнены с использованием Stata, версия 15 (StataCorp LLC).

Когда 20 участников завершили исследование, запланированный промежуточный анализ эффективности для первичной конечной точки и обзор безопасности лечения были выполнены спонсором (S.A.), который не смог найти статистически значимых различий между группами. Поскольку не было обнаружено доказательств существенного вреда от активного лечения, который мог бы мотивировать преждевременное прекращение исследования, исследование было разрешено продолжить с запланированным размером выборки в 60 человек.

Участники и вмешательство

Из 52 участников мужского пола (средний возраст [SD] 36 [12] лет) 26 (50%; 1 отказ) были рандомизированы для приема дегареликса и 26 (50%) для плацебо. Из этих 52 участников 39 (75%) проживали в городах с населением более 50000 человек.Расстояние от дома до исследовательского центра составило более 100 км для 28 участников (54%), 6 из которых (12%) проехали более 400 км. Характеристики участников описаны в таблице 2. Незначительные различия в демографических и клинических характеристиках наблюдались между двумя группами лечения на исходном уровне, но медиана (межквартильный размах [IQR]) совокупного риска была примерно одинаковой (дегареликс: 7,5 [6,0-8,0]. ] по сравнению с плацебо: 8 [6,8-9,0]) (eTable 1 в Приложении 2). Исходно была обнаружена высокая распространенность депрессии (35%).Все участники относились либо к классу риска 1 (n = 6), либо к классу риска 2 (n = 44), но 3 человека в каждой группе лечения имели исходную оценку 10 баллов и поэтому были проанализированы как подгруппа высокого риска. Среднее (IQR) количество дней от исходного уровня до посещений составляло 15 (14-18) дней на 2 неделе и 73 (73-74) дня на 10 неделе для тех, кто в группе дегареликса, и 14 (14-14) дней на 2 неделе. недель и 73 (73-77) дней на 10 неделе для тех, кто в группе плацебо. Средние (SD) уровни кастрации сывороточного тестостерона были определены через 2 недели (0.7 [0,2] нмоль / л) и 10 недель (0,6 [0,2] нмоль / л) у всех участников, рандомизированных для получения дегареликса (таблица 4 в Приложении 2).

Поскольку уровень удержания участников через 10 недель был высоким (96%; n = 50), анализ вторичных конечных точек считался возможным без достижения запланированного размера выборки в 60. Этот результат, наряду с временно низкой степенью включения, закончился набор в исследование после рандомизации 52 участников, решение, которое мы приняли до отмены слепого анализа.

Первичные и вторичные конечные точки эффективности в снижении совокупного балла риска через 2 и 10 недель существенно различались, снизившись с 7,4 до 4,4 баллов для участников в группе дегареликса и с 7,8 до 6,6 баллов для группы плацебо (средняя разница: -1,8 [95% ДИ, от –3,2 до –0,5]; P = 0,01) (Таблица 3). В моделях регрессии вторичных конечных точек статистически значимые различия наблюдались в сводных оценках риска (2 недели: –1.8 [95% ДИ, от –3,2 до –0,5]; 10 недель: -2,2 [95% ДИ, от -3,6 до -0,7]) (электронные рисунки 1 и 2 в Приложении 2) и группа высокого риска (2 недели: -3,3 [95% ДИ, от -7,9 до 1,2]; 10 недели: -6 [95% ДИ, от -10,6 до -1,4]), между педофильным расстройством (2 недели: -0,7 [95% ДИ, -1,4 до 0,0]; 10 недель: -1,1 [95% ДИ, -1,8 до -0,4]) и сексуальной озабоченности (2 недели: -0,7 [95% ДИ, от -1,2 до -0,3]; 10 недель: -0,8 [95% ДИ, от -1,3 до -0,3]) (eFigure 3 и eFigure 4 in Дополнение 2) домены. Статистически значимых различий в оценках в областях с низким уровнем эмпатии не наблюдалось (2 недели: 0.2 [95% ДИ, от -0,3 до 0,6]; 10 недель: 0,2 [95% ДИ, –0,2–0,6]), нарушение саморегуляции (2 недели: –0,0 [95% ДИ, –0,7–0,6]; 10 недель: 0,1 [95% ДИ, –0,5–0,8] ]) и риск по самооценке (2 недели: −0,4 [95% ДИ, от −0,9 до 0,1]; 10 недель: −0,5 [95% ДИ, от −1 до 0,0]) или в любом из показателей качества жизни ( Оценка индекса EQ-5D, 2 недели: 0,06 [95% ДИ, от -0,00 до 0,12] и 10 недель: 0,04 [95% ДИ, от -0,02 до 0,10]; EQ-VAS, 2 недели: 0,6 [95% ДИ, От -9,7 до 10,9] и 10 недель: 4,2 [95% ДИ, от -6,0 до 14,4]) (таблица 6 в Приложении 2).Темы и категории дополнительных интервью показаны в Таблице 4. В группе дегареликса положительное отношение к сексуальности (20 из 26 [77%]) и неблагоприятное воздействие на организм (23 из 26 [89%]) были наиболее распространенными. самооценка опыта. Анализ котировок конкретных участников представлен в Приложении 2 в Приложении 2.

Апостериорный анализ показал, что 15 из 26 участников (58%) в группе дегареликса и 3 из 26 участников (12%) в группе плацебо отрицали сексуальное влечение к несовершеннолетним через 10 недель.

В группе плацебо серьезных нежелательных явлений не наблюдалось. О серьезном нежелательном явлении в виде увеличения суицидальных мыслей сообщили 2 из 25 участников (8%) в группе дегареликса, что привело к госпитализации. Один участник сообщил о происшествии через 10 недель, когда его состояние улучшилось; другой сообщал о суицидальных идеях на начальном этапе, но был потерян для последующего наблюдения через 10 недель (предположительно также из-за расстояния> 500 км), и с ним связались по телефону.В ретроспективном анализе показатели суицидальности (2 недели: -0,3 [95% ДИ, от -0,5 до 0,1]; 10 недель: -0,1 [95% ДИ, от -0,5 до 0,3]; P = 0,33), депрессия (2 недели: 2,3 [95% ДИ, 0,3-20,7]; 10 недель: 2,0 [95% ДИ, 0,2-19,5]; P = 0,74) или тяжесть депрессии (2 недели: −3 [95% ДИ] , От -10 до 4]; 10 недель: -4 [95% ДИ, от -12 до 4]; P = 0,55) существенно не различались между группами (таблица 5 в Приложении 2).

Наиболее частым нежелательным явлением средней степени тяжести были преходящие реакции в месте инъекции через 2 недели (дегареликс: 22 из 25 [88%]; плацебо: 1 из 26 [4%]), а наиболее часто сообщаемым незначительным нежелательным явлением был уровень гепатобилиарного фермента. высоты, наибольшая из которых 3.В 5 раз выше верхней границы нормального диапазона (дегареликс: 11 из 25 [44%]; плацебо: 2 из 26 [8%]). Полное описание побочных эффектов и результатов анализа крови можно найти в eTable 2 и eTable 3 в Приложении 2.

В этом рандомизированном клиническом исследовании фазы 2 однократная доза (240 мг) дегареликса ацетата статистически значимо снижала показатели динамических факторов риска сексуального преступления с минимальными побочными эффектами среди обращающихся за помощью мужчин с педофильным расстройством, как в краткосрочной (2- неделя) и в средние (10-недельные) сроки.Препарат также был эффективен среди участников из группы высокого риска (таблица 3). Быстрое начало действия дегареликса, по-видимому, имеет решающее преимущество по сравнению с более ранними лекарствами от парафильных расстройств, которые оказывали влияние на сексуальность с задержкой от 1 до 3 месяцев. 9

Самостоятельные отчеты предоставили эмпирическую основу для принятия совместных решений с точки зрения пациента и могут облегчить лечение педофильного расстройства, ориентированное на пациента. 36 Взвешивая пользу и вред препарата, мы обнаружили, что участники самостоятельно сообщали о более позитивном, чем негативном отношении к лечению, особенно в отношении его влияния на сексуальность.Таким образом, участники выразили облегчение симптомов, по поводу которых они обращались за помощью, в дополнение к достижению лечебной цели по снижению риска. Этот вывод также может быть отражен в снижении показателей риска педофильного расстройства и сексуальной озабоченности (таблица 3). Только 1 участник был потерян для последующего наблюдения, и 58% из тех, кто был рандомизирован для приема дегареликса, пожелали продолжить лечение (Таблица 4), что указывает нам на потенциальную роль длительного лечения наряду с психологической поддержкой для большинства участников.В конечном итоге решение о лечении принимает врач, который должен учитывать риск злоупотребления, предпочтения пациента, а также пользу и вред лекарств. Принимая во внимание пожелания участников и результаты, выраженные в самоотчетах, мы считаем, что дегареликс следует рассматривать для обращающихся за помощью лиц с педофильным расстройством. Поддерживаемая мотивация участников к такой мощной терапии и низкие рейтинги EQ-VAS отражают серьезность и связанный с этим дистресс состояния. Однако умеренное влияние на качество жизни, связанное с лечением основных симптомов педофильного расстройства, указывает на необходимость лучшего понимания причин борьбы, с которой сталкиваются люди с этим заболеванием.

В будущих исследованиях необходимо рассмотреть эффекты и предсказуемые долгосрочные неблагоприятные эффекты гормональной недостаточности, а также иногда чрезмерное влияние на сексуальность, как сообщили участники (Таблица 4; электронные рисунки 3 и 4 в Приложении 2). В этом отношении можно рассмотреть возможность дополнительной терапии с добавлением гормонов. 37 Учитывая, что 2 участника сообщили о серьезных побочных эффектах суицидальных мыслей, необходимо проявлять бдительность в отношении риска обострения суицидальности у предрасположенных лиц.Хотя депрессивные симптомы иногда являются проявлениями гипогонадизма, 12-месячное открытое испытание дегареликса у пациентов с раком простаты (n = 409) показало депрессию как нежелательное явление только у 1 человека. 38 Высокая исходная распространенность депрессии в настоящем исследовании (35%) может указывать на расширенную выборку лиц, подверженных депрессивному ухудшению от лечения антагонистами гонадотропин-рилизинг-гормона. Однако большинство участников могут быть невосприимчивыми.При ретроспективном сравнении групп лечения в течение периода исследования (таблица 5 в Приложении 2) не наблюдалось различий в изменении значений самооценки по шкале оценки депрессии Монтгомери-Асберга (MADRS-S) по степени тяжести депрессии, частоте возникновения дистимии. , депрессия или риск самоубийства. Хотя неопределенность из-за недостаточной мощности и апостериорного анализа оставалась, большинство оценок в пределах ДИ разницы в баллах MADRS-S через 10 недель между группами указывало на уменьшение (10 недель: -4 [95% ДИ, от -12 до 4]) среди участники, которые были рандомизированы для получения дегареликса.При включении показателей MADRS-S всех участников мы обнаружили, что разница через 10 недель увеличилась (данные не показаны).

Кроме того, в будущих исследованиях необходимо выявить факторы риска, которым полезны другие виды вмешательства, такие как психотерапия. Нарушение саморегуляции и низкий уровень эмпатии в настоящем исследовании выявили остаточный риск, не поддающийся лечению дегареликсом. Ненормальные результаты этих показателей в клинических условиях обычно связаны с синдромом дефицита внимания / гиперактивности или аутичными особенностями.Мы думаем, что если эти условия будут надлежащим образом устранены, существует потенциал как для улучшения здоровья, так и для снижения риска совершения сексуальных преступлений в отношении детей.

Сильные стороны и ограничения

У этого испытания есть свои сильные стороны. Высокие показатели включения, разнообразное географическое происхождение участников и сопутствующие заболевания предполагают возможность обобщения результатов исследования на другие группы населения, обращающиеся за помощью.Хотя несколько участников сообщили о предыдущих контактных нарушениях, результаты согласуются с выводами предыдущих неслепых когорт осужденных преступников, которые указали на эффективность подавления тестостерона в снижении сексуальных симптомов в этой популяции. 12 , 14

Однако это исследование также имеет некоторые ограничения. Его результаты относятся только к мужчинам, мера риска основана в основном на самоотчетах, а полученные результаты еще не подтверждены фактическими показателями жестокого обращения.Следовательно, еще предстоит определить количество случаев сексуального насилия над детьми, которые удалось предотвратить с помощью сниженной оценки факторов риска. Кроме того, предварительно заданное клинически значимое снижение на 5 баллов не было достигнуто, за исключением участников, которые были отнесены к группе высокого риска (Таблица 3).

Лечение дегареликсом, по-видимому, снижает показатели факторов риска сексуального насилия над детьми после 2 недель приема для обращающихся за помощью мужчин с педофильным расстройством.

Принято к публикации: 9 февраля 2020 г.

Опубликовано в Интернете: 29 апреля 2020 г. doi: 10.1001 / jamapsychiatry.2020.0440

Открытый доступ: Это статья в открытом доступе, распространяемая в соответствии с условиями Лицензия CC-BY. © 2020 Landgren V et al. JAMA Psychiatry .

Автор для корреспонденции: Кристоффер Рам, доктор медицины, Стокгольмские службы здравоохранения, регион Стокгольм, Norra Stationsgatan 69, SE-113 64 Стокгольм, Швеция ([email protected]).

Вклад авторов: Доктор Рам был главным исследователем. Д-р Рам имел полный доступ ко всем данным в исследовании и берет на себя ответственность за целостность данных и точность анализа данных.

Концепция и дизайн: Arver, Rahm.

Сбор, анализ или интерпретация данных: Все авторы.

Составление рукописи: Ландгрен, Малки, Рам.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Ландгрен, Боттаи, Арвер, Рам.

Статистический анализ: Bottai, Rahm.

Полученное финансирование: Арвер, Рам.

Административная, техническая или материальная поддержка: Arver, Rahm.

Надзор: Арвер, Рам.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Это исследование финансировалось Медицинским обществом Гетеборга; Шведское медицинское общество; Фонд Седерстрёма Кёнига; Фонд Фредрика и Ингрид Тюринг; Центр психиатрических исследований, отделение клинической неврологии, Каролинский институт; исследовательское отделение больницы Скараборг; и нефармацевтические академические источники, а также за счет грантов в соответствии с соглашением ALF между правительством Швеции и советами стран.

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

Заявление об обмене данными : См. Приложение 3.

Дополнительные материалы: Пиа Дженсен и Сюзанн Ярлвик Альм, обе из больницы Каролинского университета, оказали помощь в организации исследования и сборе данных; Анна Фенандер Хедин, больница Каролинского университета, оказала помощь в сборе данных; и Никлас Ют, Каролинский институт, помогли с анализом данных.Эти люди не получали никакой дополнительной компенсации за свои взносы, кроме их обычной заработной платы.

1.Коллин-Везина D, Дайно Я, Эбер М. Уроки, извлеченные из исследования сексуального насилия над детьми: распространенность, результаты и превентивные стратегии. Психиатрическая психиатрия для детей и подростков . 2013; 7 (1): 22. DOI: 10.1186 / 1753-2000-7-22 PubMedGoogle ScholarCrossref 2.Stoltenborgh М., ван Эйзендорн MH, Эйзер EM, Бакерманс-Краненбург MJ.Глобальный взгляд на сексуальное насилие над детьми: метаанализ распространенности во всем мире. Детское насилие . 2011; 16 (2): 79-101. DOI: 10.1177 / 1077559511403920 PubMedGoogle ScholarCrossref 4.

Хан О, Ферритер М, Хубанд N, Пауни MJ, Деннис JA, Дагган C. Фармакологические вмешательства для тех, кто совершил сексуальное преступление или находится в группе риска. Кокрановская база данных систематических обзоров. Версия вмешательства опубликована 18 февраля 2015 г.По состоянию на 9 сентября 2019 г.

5.Långström N, Энебринк П, Лорен Э-М, Линдблом J, Werkö S, Hanson РК. Предотвращение повторного совершения сексуального насилия над детьми: систематический обзор медицинских и психологических вмешательств. BMJ . 2013; 347: f4630. DOI: 10.1136 / bmj.f4630 PubMedGoogle ScholarCrossref 7.

Seto MC. Педофилия и сексуальные преступления в отношении детей: теория, оценка и вмешательство .2-е изд. Американская психологическая ассоциация; 2018.

8. Бейер КМ, Алерс CJ, Goecker D, и другие. Можно ли привлечь педофилов для первичной профилактики сексуального насилия над детьми? Первые результаты Берлинского профилактического проекта Дункельфельд (PPD). J Судебная психиатрия Psychol . 2009; 20 (6): 851-867. DOI: 10.1080 / 14789940

4188 Google ScholarCrossref 9.Thibaut F, Де ла Барра F, Гордон H, Cosyns П, Брэдфорд JM; Целевая группа WFSBP по сексуальным расстройствам.Рекомендации Всемирной федерации обществ биологической психиатрии (WFSBP) по биологическому лечению парафилий. Мировая биология психиатрии . 2010; 11 (4): 604-655. DOI: 10.3109 / 15622971003671628 PubMedGoogle ScholarCrossref 11.Turner Д, Петерманн J, Харрисон К. Крюгер R, Briken П. Фармакологическое лечение пациентов с парафилическими расстройствами и риском сексуальных преступлений: международная перспектива. Всемирная биологическая психиатрия .2019; 20 (8): 616-625. DOI: 10.1080 / 15622975.2017.1395069PubMedGoogle ScholarCrossref 12.Turner D, Briken П. Лечение парафильных расстройств у лиц, совершивших сексуальные преступления, или мужчин с риском сексуальных преступлений с помощью агонистов лютеинизирующего гормона-рилизинг-гормона: обновленный систематический обзор. Дж. Секс Мед . 2018; 15 (1): 77-93. DOI: 10.1016 / j.jsxm.2017.11.013 PubMedGoogle ScholarCrossref 18. van Honk Дж., Шуттер DJ, Бос PA, Kruijt A-W, Lentjes EG, Барон-Коэн S.Введение тестостерона ухудшает когнитивную эмпатию у женщин в зависимости от соотношения второй и четвертой цифр. Proc Natl Acad Sci U S A . 2011; 108 (8): 3448-3452. DOI: 10.1073 / pnas.10118 PubMedGoogle ScholarCrossref 22.Reid RC, Гарос S, плотник Б.Н. Надежность, валидность и психометрическое развитие Опросника гиперсексуального поведения в амбулаторной выборке мужчин. Компульсивность секс-наркомана . 2011; 18 (1): 30-51. DOI: 10.1080 / 10720162.2011.555709 Google ScholarCrossref 23.

Conners СК. Тест непрерывной производительности Коннерса II (CPT II V.5) . Multi-Health Systems, Inc; 2000.

25. Барон-Коэн С, Уилрайт S, холм J, Расте Y, отвес Я. Пересмотренная версия теста «Читая мысли по глазам»: исследование с участием нормальных взрослых и взрослых с синдромом Аспергера или высокофункциональным аутизмом. J Детская психическая психиатрия . 2001; 42 (2): 241-251.DOI: 10.1111 / 1469-7610.00715 PubMedGoogle ScholarCrossref 35.Kessler ЖК, Адлер L, Эймс М, и другие. Шкала самооценки СДВГ среди взрослых Всемирной организации здравоохранения (ASRS): короткая шкала скрининга для использования среди населения в целом. Психол Мед . 2005; 35 (2): 245-256. DOI: 10.1017 / S00332002892 PubMedGoogle ScholarCrossref 37.Carr BR, Стюарт EA, Лучник DF, и другие. Элаголикс отдельно или с дополнительной терапией у женщин с обильным менструальным кровотечением и лейомиомой матки: рандомизированное контролируемое исследование. Акушерский гинеколь . 2018; 132 (5): 1252-1264. DOI: 10.1097 / AOG.0000000000002933 PubMedGoogle ScholarCrossref 38.Klotz L, Боккон-Гибод L, берег ND, и другие. Эффективность и безопасность дегареликса: 12-месячное сравнительное рандомизированное открытое исследование III фазы в параллельных группах у пациентов с раком простаты. БЖУ Инт . 2008; 102 (11): 1531-1538. DOI: 10.1111 / j.1464-410X.2008.08183.x PubMedGoogle ScholarCrossref

обоюдоострый меч гонадотропин-рилизинг гормона (GnRH): новая роль GnRH во множестве полезных функций стволовых клеток эндометрия

  • 1.

    Лимонта, П., Моретти, Р. М., Марелли, М. М. и Мотта, М. Биология гормона, высвобождающего гонадотропный гормон: роль в контроле роста и прогрессирования опухоли у людей. Фронт. Нейроэндокринол. 24 , 279–295 (2003).

    Артикул PubMed CAS Google ученый

  • 2.

    Neill, J. D. Гены рецепторов GnRH и GnRH в геноме человека. Эндокринология 143 , 737–743 (2002).

    Артикул PubMed CAS Google ученый

  • 3.

    Кумар П. и Шарма А. Аналоги гонадотропин-рилизинг гормона: понимание преимуществ и ограничений. J. Hum. Репродукция. Sci. 7 , 170–174 (2014).

    Артикул PubMed PubMed Central CAS Google ученый

  • 4.

    Depalo, R. et al. Агонист ГнРГ в сравнении с антагонистом ГнРГ при экстракорпоральном оплодотворении и переносе эмбриона (ЭКО / ЭТ). Репродукция. Биол. Эндокринол. 10 , 26 (2012).

    Артикул PubMed PubMed Central CAS Google ученый

  • 5.

    Lai, Q. et al. Сравнение протокола агонистов и антагонистов ГнРГ у одних и тех же пациенток при вспомогательной репродукции во время контролируемых циклов стимуляции яичников. Внутр. J. Clin. Exp. Патол. 6 , 1903–1910 (2013).

    PubMed PubMed Central Google ученый

  • 6.

    Лукас, Э. С., Салкер, М. С. и Бросенс, Дж. Дж. Пластичность матки и репродуктивная способность. Репродукция. Биомед. 27 , 506–514 (2013).

    Артикул Google ученый

  • 7.

    МакЛеннан, К. Э. и Райделл, А. Х. Степень отторжения эндометрия во время нормальной менструации. Акушерство. Гинеколь. 26 , 605–621 (1965).

    PubMed CAS Google ученый

  • 8.

    Омидвар С. и Бегум К. Менструальный цикл у незамужних женщин из южной Индии. J. Nat. Sci. Биол. Med. 2 , 174–179 (2011).

    Артикул PubMed PubMed Central Google ученый

  • 9.

    Лай, Т. Х., Чанг, Ф. У., Лин, Дж. Дж. И Линг, К. Д. Экспрессия гена лиганда L-селектина эндометрия человека в зависимости от фаз естественного менструального цикла. Sci. Отчет 8 , 1443 (2018).

    Артикул PubMed PubMed Central CAS Google ученый

  • 10.

    Сандерсон П. А., Кричли Х. О., Уильямс А. Р., Арендс М. Дж. И Сондерс П. Т. Новые концепции для старой проблемы: диагностика гиперплазии эндометрия. Hum. Репродукция. Обновление 23 , 232–254 (2017).

    PubMed Google ученый

  • 11.

    Гаргетт, К.Э., Нгуен, Х. П. и Е, Л. Регенерация эндометрия и стволовые клетки / клетки-предшественники эндометрия. Rev. Endocr. Метаб. Disord. 13 , 235–251 (2012).

    Артикул PubMed CAS Google ученый

  • 12.

    Гаргетт, К. Э. и Йе, Л. Реконструкция эндометрия из стволовых клеток. Fertil. Стерил. 98 , 11–20 (2012).

    Артикул PubMed Google ученый

  • 13.

    Lucas, E. S. et al. Потеря пластичности эндометрия при повторной потере беременности. Стволовые клетки 34 , 346–356 (2016).

    Артикул PubMed CAS Google ученый

  • 14.

    Ходр, Г. С. и Силер-Ходр, Т. М. Плацентарный фактор высвобождения лютеинизирующего гормона и его синтез. Наука 207 , 315–317 (1980).

    Артикул PubMed CAS Google ученый

  • 15.

    Канг, С. К., Тай, К. Дж., Натвани, П. С. и Люнг, П. С. Дифференциальная регуляция двух форм рибонуклеиновой кислоты-мессенджера гонадотропин-рилизинг-гормона в гранулезно-лютеиновых клетках человека. Эндокринология 142 , 182–192 (2001).

    Артикул PubMed CAS Google ученый

  • 16.

    Ирмер Г., Бургер К., Ортманн О., Шульц К. Д. и Эмонс Г. Экспрессия гормона высвобождения лютеинизирующего гормона и его мРНК в клеточных линиях рака эндометрия человека. J. Clin. Эндокринол. Метаб. 79 , 916–919 (1994).

    PubMed CAS Google ученый

  • 17.

    Weng, H., Liu, F., Hu, S., Li, L. & Wang, Y. Агонисты GnRH индуцируют апоптоз эпителиальных клеток эндометрия посредством подавления GRP78. J. Transl. Med. 12 , 306 (2014).

    Артикул PubMed PubMed Central CAS Google ученый

  • 18.

    Эрсой, Г.С., Золбин, М.М., Косар, Э., Мамиллапалли, Р. и Тейлор, Х.С. Медицинские методы лечения эндометриоза по-разному подавляют рекрутирование стволовых клеток. Репродукция. Sci. 24 , 818–823 (2017).

    Артикул PubMed CAS Google ученый

  • 19.

    Forte, G. et al. Влияние фактора роста гепатоцитов на мезенхимальные стволовые клетки: пролиферация, миграция и дифференцировка. стволовые клетки 24 , 23–33 (2006).

    Артикул PubMed CAS Google ученый

  • 20.

    Gharibi, B., Ghuman, M. S. & Hughes, F. J. Akt- и Erk-опосредованная регуляция пролиферации и дифференцировки во время индуцированного PDGFRbeta самообновления МСК. J. Cell Mol. Med. 16 , 2789–2801 (2012).

    Артикул PubMed PubMed Central CAS Google ученый

  • 21.

    Zheng, B. et al. Нейральная дифференцировка мезенхимальных стволовых клеток влияет на хемотаксические реакции на HGF. J. Cell Physiol. 228 , 149–162 (2013).

    Артикул PubMed CAS Google ученый

  • 22.

    Song, B.Q. et al. Ингибирование передачи сигналов Notch способствует адипогенной дифференцировке мезенхимальных стволовых клеток посредством активации аутофагии и пути PTEN-PI3K / AKT / mTOR. Cell Physiol.Biochem. 36 , 1991–2002 (2015).

    Артикул PubMed CAS Google ученый

  • 23.

    Tang, J. M. et al. Ацетилхолин вызывает миграцию мезенхимальных стволовых клеток через сигнальный путь Ca2 + / PKC / ERK1 / 2. J. Cell Biochem. 113 , 2704–2713 (2012).

    Артикул PubMed PubMed Central CAS Google ученый

  • 24.

    Ямагути, Х. и Кондилис, Дж. Регуляция актинового цитоскелета при миграции и инвазии раковых клеток. Biochim. Биофиз. Acta 1773 , 642–652 (2007).

    Артикул PubMed CAS Google ученый

  • 25.

    Агравал, Р., Холмс, Дж. И Джейкобс, Х.С. Фолликулостимулирующий гормон или менопаузальный гонадотропин человека для стимуляции яичников в циклах экстракорпорального оплодотворения: метаанализ. Fertil. Стерил. 73 , 338–343 (2000).

    Артикул PubMed CAS Google ученый

  • 26.

    Конн, П. М. и Кроули, В. Ф. Младший Гонадотропин-рилизинг-гормон и его аналоги. Annu. Rev. Med. 45 , 391–405 (1994).

    Артикул PubMed CAS Google ученый

  • 27.

    Силфон, С. К., Вайнштейн, Х.И Миллар, Р. П. Молекулярные механизмы взаимодействия лиганда с рецептором гонадотропин-рилизинг-гормона. Endocr. Ред. 18 , 180–205 (1997).

    Артикул PubMed CAS Google ученый

  • 28.

    Armstrong, L. et al. Роль передачи сигналов PI3K / AKT, MAPK / ERK и NFkappabeta в поддержании плюрипотентности и жизнеспособности эмбриональных стволовых клеток человека подчеркнута с помощью профилирования транскрипции и функционального анализа. Hum. Мол. Genet. 15 , 1894–1913 (2006).

    Артикул PubMed CAS Google ученый

  • 29.

    Muller, P., Langenbach, A., Kaminski, A. & Rychly, J. Модуляция актинового цитоскелета влияет на механически индуцированную передачу сигнала и дифференцировку в мезенхимальных стволовых клетках. PLoS ONE 8 , e71283 (2013).

    Артикул PubMed PubMed Central CAS Google ученый

  • 30.

    Gao, F., Hu, X., Xie, X., Liu, X. & Wang, J. Белок теплового шока 90 стимулирует миграцию мезенхимальных стволовых клеток крыс через пути PI3K / Akt и ERK1 / 2. Cell Biochem. Биофиз. 71 , 481–489 (2015).

    Артикул PubMed CAS Google ученый

  • 31.

    Myers, A. L. et al. IGFBP2 модулирует химиорезистентный фенотип аденокарциномы пищевода. Oncotarget 6 , 25897–25916 (2015).

    Артикул PubMed PubMed Central Google ученый

  • 32.

    Yang, Y. et al. Подавление белка 6, связывающего инсулиноподобный фактор роста, связано с ростом аденомы гипофиза, секретирующей АКТГ. Гипофиз 17 , 505–513 (2014).

    Артикул PubMed CAS Google ученый

  • 33.

    Аплин Дж. Д. и Руан П. Т.Обзор взаимодействия эмбриона и эпителия во время имплантации. J. Cell Sci. 130 , 15–22 (2017).

    Артикул PubMed CAS Google ученый

  • 34.

    Altmae, S. et al. Ресурсы исследования: интерактом имплантации эмбриона человека: определение путей экспрессии генов, регуляция и интегрированные регуляторные сети. Мол. Эндокринол. 26 , 203–217 (2012).

    Артикул PubMed CAS Google ученый

  • 35.

    Демир Р., Яба А. и Хуппертц Б. Васкулогенез и ангиогенез в эндометрии во время менструального цикла и имплантации. Acta Histochem. 112 , 203–214 (2010).

    Артикул PubMed CAS Google ученый

  • 36.

    Морелли, С. С., Йи, П. и Голдсмит, Л. Т. Стволовые клетки эндометрия и репродукция. Акушерство. Гинеколь. Int. 2012 , 851367 (2012).

    Артикул PubMed PubMed Central CAS Google ученый

  • 37.

    Лукас, Э. С., Дайер, Н. П., Фишвик, К., Отт, С. и Бросенс, Дж. Дж. Успех после неудачи: роль стволовых клеток эндометрия в повторном невынашивании беременности. Репродукция 152 , R159 – R166 (2016).

    Артикул PubMed CAS Google ученый

  • 38.

    Maggi R., et al. Рецепторы GnRH и GnRH в патофизиологии женской репродуктивной системы человека. Обновление Hum Reprod 22 , 358–381 (2016).

  • 39.

    Metallinou, C., Asimakopoulos, B., Schroer, A. & Nikolettos, N. Гонадотропин-высвобождающий гормон в яичниках. Репродукция. Sci. 14 , 737–749 (2007).

    Артикул PubMed CAS Google ученый

  • 40.

    Казан, Э. М., Рага, Ф., Бонилья-Мусолес, Ф. и Полан, М. Л. Человеческий яйцеводный гонадотропин-рилизинг-гормон: возможные последствия для оплодотворения, раннего эмбрионального развития и имплантации. J. Clin. Эндокринол. Метаб. 85 , 1377–1381 (2000).

    PubMed CAS Google ученый

  • 41.

    Wolfahrt, S., Kleine, B., Jarry, H. & Rossmanith, W.G. Эндогенная регуляция рецептора GnRH с помощью GnRH в плаценте человека. Мол. Гм. Репродукция. 7 , 89–95 (2001).

    Артикул PubMed CAS Google ученый

  • 42.

    Тиева А., Статтин П., Викстром П., Берг А. и Дамбер Дж. Э. Экспрессия рецептора гонадотропин-рилизинг-гормона в простате человека. Простата 47 , 276–284 (2001).

    Артикул PubMed CAS Google ученый

  • 43.

    Clayton, RN, Katikineni, M., Chan, V., Dufau, ML & Catt, KJ Прямое ингибирование функции яичек гонадотропин-рилизинг-гормоном: опосредование специфическими рецепторами гонадотропин-рилизинг-гормона в интерстициальных клетках Proc.Natl Acad. Sci. США 77 , 4459–4463 (1980).

    Артикул PubMed CAS Google ученый

  • 44.

    Chen, A. et al. Две формы гонадотропин-рилизинг-гормона (GnRH) экспрессируются в ткани груди человека и сверхэкспрессируются при раке груди: предполагаемый механизм антипролиферативного эффекта GnRH путем подавления регуляции кислых рибосомных фосфопротеинов P1 и P2. Cancer Res. 62 , 1036–1044 (2002).

    PubMed CAS Google ученый

  • 45.

    Wu, H. M. et al. Гонадотропин-рилизинг-гормон типа II индуцирует апоптоз клеток рака эндометрия человека путем активации GADD45alpha. Cancer Res. 69 , 4202–4208 (2009).

    Артикул PubMed CAS Google ученый

  • 46.

    Tsui, K. H. et al. Влияние агониста гонадотропин-рилизинг-гормона на клетки рака яичников ES-2. Тайвань. J. Obstet. Гинеколь. 53 , 35–42 (2014).

    Артикул PubMed Google ученый

  • 47.

    Краус С., Наор З. и Сегер Р. Гонадотропин-рилизинг-гормон в апоптозе клеток рака простаты. Cancer Lett. 234 , 109–123 (2006).

    Артикул PubMed CAS Google ученый

  • 48.

    Мересман Г.F. et al. Агонист гонадотропин-рилизинг-гормона вызывает апоптоз и снижает пролиферацию клеток в эутопных культурах эндометрия от женщин с эндометриозом. Fertil. Стерил. 80 (Дополнение 2), 702–707 (2003).

    Артикул PubMed Google ученый

  • 49.

    Borroni, R. et al. Экспрессия гена рецептора GnRH в эктопических клетках эндометрия человека и ингибирование их пролиферации ацетатом лейпролида. Мол. Клеточный эндокринол. 159 , 37–43 (2000).

    Артикул PubMed CAS Google ученый

  • 50.

    ван дер Линден М., Бэкингем К., Фаркуар К., Кремер Дж. А., Метвалли М. Поддержка лютеиновой фазы для циклов вспомогательной репродукции. Кокрановская база данных Syst. Ред. . CD009154 (2015).

  • 51.

    Hossini, A. M. et al. Путь передачи сигналов PI3K / AKT важен для выживания индуцированных плюрипотентных стволовых клеток. PLoS ONE 11 , e0154770 (2016).

    Артикул PubMed PubMed Central CAS Google ученый

  • 52.

    Чен, Дж., Кроуфорд, Р., Чен, С. и Сяо, Ю. Ключевые регуляторные роли сигнального пути PI3K / Akt в функциях мезенхимальных стволовых клеток и их применения в регенерации тканей. Tissue Eng. Часть B Ред. 19 , 516–528 (2013).

    Артикул PubMed CAS Google ученый

  • 53.

    Choi, E. S. et al. Миелоидноклеточный лейкоз-1 является ключевой молекулярной мишенью для индуцированного митрамицином А апоптоза в андрогеннезависимых раковых клетках простаты и на животной модели ксенотрансплантата опухоли. Cancer Lett. 328 , 65–72 (2013).

    Артикул PubMed CAS Google ученый

  • 54.

    Dong, H.J. et al. Каскад передачи сигналов Wnt / бета-катенин / Id2 опосредует эффекты гипоксии на иерархию стволовых клеток колоректального рака. Sci. Отчет 6 , 22966 (2016).

    Артикул PubMed PubMed Central CAS Google ученый

  • Гонадотропин-высвобождающий гормон (GnRH) и рецептор GnRH (GnRHR)

    9102 80

    1

    Conn PM and Crowley Jr. WF: гонадотропин-рилизинг-гормон и его аналоги. Annu Rev Med 45: 391-405, 1994

    2

    Wetsel WC, Srinivasan S: обработка Pro-GnRH.Prog Brain Res 141: 221-241, 2002

    3

    Schwanzel-Fukada M и Pfaff DW: Происхождение нейронов высвобождающего гормона лютеинизирующего гормона. Природа. 338 6211: 161-164

    4

    Wierman ME, Kiseljak-Vassiliades K, Tobet S: гонадотропин-высвобождающий гормон (GnRH) этапы миграции нейронов в качестве критических этапов поддержания и поддержания миграции. обеспечить нормальную репродуктивную функцию.Front Neuroendocrinol 32 (1): 43-52, 2011

    5

    Schwanzel-Fukada M и Pfaff DW: Происхождение нейронов высвобождающего гормона лютеинизирующего гормона. Природа. 338. J Neurosci 7: 2312, 1987

    7

    Knobil E: открытие гипоталамического генератора импульсов гонадотропин-высвобождающего гормона и его физиологического значения.Эндокринология 131: 1005-1006, 1992

    8

    Belchetz PE, Plant TM, Nakai Y, Keogh EJ, Knobil E: Гипофизические реакции на непрерывную и периодическую доставку гормона-гонона и гипоталамуса. . Science 202: 631-633, 1978

    9

    Константин, S: Физиология гонадотропин-высвобождающего гормона (GnRH Neurone: Исследования на эмбриональных нейронах GnRH).J Neuroendocrinol 23: 542-553, 2011

    10

    Wetsel WC, Valença MM, Merchenthaler I. Proc Natl Acad Sci 89: 4149-4153, 1992

    11

    Waldhauser F, Weibenbacher G, Frisch H, Pollaak A: Пульсирующая секреция гонадотропинов в раннем детстве.Eur J Pediatr 137: 71-74, 1981

    12

    Blogowska A, Rzepka-Gorska I, Krzyzanowska-Swiniarska B et al: Лептин, эндопептид Y, бета-нейропептид Y, и уровни эстрадиола у девочек перед менархе. Гинекол Эндокринол 17: 7-12, 2003

    13

    Маккартни CR: Созревание механизма секреции гонадотропин-высвобождающего гормона во сне и бодрствовании через половое созревание и патогенез патогенеза у девочек Синдром яичников.J Neuroendocrinol 22: 701-709, 2010

    14

    Reame N, Sauder SE, Kelch RP, Marshall JC: Пульсирующая секреция гонадотропинов во время менструального цикла человека: данные секреция гормона высвобождения. J Clin Endocrinol Metab 59: 328-337, 1984

    15

    Nippoldt TB, Reame NE, Kelch RP, Marshall JC: Роль эстрадиола и гормона прогестерона в снижении частоты пульса в лютеинизации лютеиновая фаза менструального цикла.J Clin Endocrinol Metab 69: 67-76, 1989

    16

    Hall JE, Schoenfeld DA, Martin KA, Crowley WF, Jr .: Гипоталамический гонадотропный гормон, высвобождающий фолликулярный гормон. гормональная динамика при лютеинно-фолликулярном переходе. J Clin Endocrinol Metab 74: 600-607, 1992

    17

    Hall JE, Lavoie HB, Marsh EE, Martin KA: Снижение гонадотропин-высвобождающего гормона пульса (GnRH) у женщин в постменопаузе.J Clin Endocrinol Metab 85: 1794-1800, 2000

    18

    Johnson J, Skaznik-Wikiel M, Lee HJ, Niikura Y, Tilly JC, Tilly JL: установив рекорд данные, подтверждающие постнатальный оогенез у самок млекопитающих. Cell Cycle 4: 1471-1477, 2005

    19

    Zou K, Yuan Z, Yang Z et al. Производство потомства из линии стволовых клеток зародышевой линии, полученных из неонатальных яичников.Nat Cell Biol 11: 631-636, 2009

    20

    Herbison AE, Pape JR: Новые данные о рецепторах эстрогена в нейронах гонадотропин-рилизинг-гормона. Front Neuroendocrinol 22: 292-308, 2001

    21

    Hu L, Gustofson RL, Feng H, Leung PK, Mores N, Krsmanovic LZ, Catt KJ: Обратные регуляторные функции эстрогеновых рецепторов -альфа- и -бета-подтипы, экспрессируемые в нейронах гипоталамического гонадотропин-рилизинг-гормона.Mol Endocrinol 22: 2250-2259, 2008

    22

    Шоу Н.Д., Хистед С.Н., Сроуджи С.С. и др.: Отрицательная обратная связь эстрогена на секрецию гонадотропина: доказательства прямого гипофизарного эффекта у женщин. J Clin Endocrinol Metab 95: 1955-1961, 2010

    23

    Marshall JC, Case GD, Valk TW, Corley KP, Sauder SE, Kelch RP. Селективное подавление секреции фолликулостимулирующего гормона эстрадиолом.Механизм модуляции ответа гонадотропина на импульсы низкой дозы гонадотропин-рилизинг-гормона. J Clin Invest 71: 248-257, 1983

    24

    Karsch FJ, Weick RF, Butler WR, Dierschke DJ, Krey LC, Weiss G, Hotchkiss J, Yamaji T, Knobil E : Индуцированный выброс ЛГ у макаки-резуса: силовые характеристики эстрогенового стимула. Эндокринология 92: 1740-1747, 1973

    25

    Nakai Y, Plant TM, Hess DL et al: На сайтах отрицательной и положительной обратной связи действия эстрадиола в контроле гонадотропина секреция у макаки-резуса.Эндокринология 102: 1008, 1978

    26

    Knobil E: Нейроэндокринный контроль менструального цикла. Rec Prog Horm Res 36:53, 1980

    27

    Ferin M, Rosenblatt H, Carmel PW et al: Вызванные эстрогеном выбросы гонадотропина у самок макак-резусов после перерезки гипофиза. Endocrinology 104: 50, 1979

    28

    Nippoldt TB, Reame NE, Kelch RP, Marshall JC: Роль эстрадиола и прогестерона в снижении частоты импульсов лютеинизирующего гормона в фазах лютеинизирующего гормона в лютеинизирующем гормоне. менструальный цикл.J Clin Endocrinol Metab 69: 67-76, 1989

    29

    Soules MR, Steiner RA, Clifton DK, et al: Модуляция прогестероном пульсирующей секреции лютеинзирующего гормона у нормальных женщин. J Clin Endocrionol Metab 58: 378-383, 1984

    30

    Howlett TA, Rees LH: Эндогенные опиоидные пептиды и функция гипоталамо-гипофиза. Annu Rev Physiol 48: 527-536, 1986

    31

    McShane TM, May T, Miner JL, Keisler DH: центральное действие нейропептида-Y может обеспечивать нейромодулирующую связь между питанием и размножение.Biol Reprod 46: 1151-1157, 1992

    32

    Pielecka-Fortuna J, Chu Z, Moenter SM: Kisspeptin действует прямо и косвенно, увеличивая активность гонадотропина и его гормон-релизинг. модулируются эстрадиолом. Эндокринология 149: 1979-1986, 2008

    33

    Роа Дж., Наварро В.М., Тена-Семпере М.: Кисспептины в репродуктивной биологии: согласованные знания и последние разработки.Biol Reprod 85: 650-660, 2011

    34

    Tena-Sempere M: Передача сигналов кисспептина в головном мозге: последние разработки и будущие проблемы. Молекулярная и клеточная эндокринология 314: 164-169, 2010

    35

    Teles MG, Bianco SD, Brito SD et al: Мутация, активирующая GPR54 у пациента с центральным преждевременным половым созреванием. N Eng J Med 358: 709-715, 2008

    36

    Gutierrez-Pascual E, Martinez-Fuentes AJ, Pinilla L et al: Прямые гипофизарные эффекты кисспептина: активация гонадотропов соматотрофы и стимуляция секреции лютеинизирующего гормона и гормона роста.J Neuroendocrinol 19: 521-530, 2007

    37

    Luque RM, Cordoba-Chacon J, Gahete MD et al: Кисспептин регулирует различные функции гонадотрофов и соматотрофов у общих и не соматотрофных функций сигнальные механизмы. Endocrinology 152: 957-966, 2011

    38

    Castellnao JM, Navarro VM, Fernandez-Fernandez R et al. гормональная система крысы.Mol Cell Endocrionol 257-258: 75-83, 2006

    39

    Tena-Sempere M: роль кисспептинов в контроле гипоталамо-гонадотропной функции: сосредоточение внимания на половой дифференциации . Endocr Dev 17: 52-62, 2010

    40

    Han SK, Gottsch ML, Lee KJ et al: Активация нейронов гонадотропин-высвобождающего гормона кисспептином в качестве нейроэндокринного переключателя полового созревания.J Neurosci. 25: 11349-11356, 2005

    41

    Rometo AM, Krajewski SJ, Voytko ML, Rance NE: Гипертрофия и повышенная экспрессия гена кисспептина у женщин с мононуклеарной инфундибулярной связью с гипоталамией и инфундибулярной инфундибулярной связью. . J Clin Endocrinol Metab 92: 2744-2750, 2007

    42

    Dumalska L, Wu M, Morozova E et al: Возбуждающие эффекты инициирующего половое созревание пептида, метаболизма I кисспептина и группы Агонисты рецепторов различают две отдельные субпопуляции нейронов гонадотропин-рилизинг-гормона.J Neurosci 28: 8003-8013, 2008

    43

    Кауфман А.С., Готч М.Л., Роа Дж. И др.: Половая дифференциация экспрессии гена Kiss1 в мозге крысы. Endocrinology 148: 1774-1783, 2007

    44

    Quennell JH, Howell CS, Roa J, Augustine RA и др.: Дефицит лептина и вызванное диетой ожирение снижают гипоталамический кисспептин.Эндокринология 152: 1541-1550, 2011

    45

    Элиас CF: Действие лептина в пубертатном периоде: последние достижения и вопросы без ответов. Trends Endocrinol Metab 23: 9-15, 2012

    46

    Kim HH: Регулирование экспрессии гена гонадотропин-высвобождающего гормона. Semin Reprod Med 25: 313-325, 2007

    47

    White et al: Второй ген ГнРГ у людей.Proc Natl Acad Sci USA 95: 305-309, 1998

    48

    Скиннер, округ Колумбия, Альбертсон А.Дж., Навратил А, Смит А., Миньот М., Талботт Х, Сканлан-Блейк Н: Эффекты гонадотропин-рилизинг гормона за пределами гипоталамо-гипофизарно-репродуктивной оси. J Neuroendocrinol 21: 282-292, 2009

    49

    Hong IS, Cheung AP, Leung PC: гонадотропин-высвобождающие гормоны I и II вызывают апоптоз в клетках гранулезы человека.J Clin Endocrinol Metab 93: 3179-3185, 2008

    50

    Миллар, RP: ГнРГ и рецепторы ГнРГ. Anim Repro Sci 88: 5-28, 2005

    51

    Миллар РП: рецепторы ГнРГ II и типа II. Тенденции Endocr Metabol 14: 35-43, 2003

    52

    King JA et al: Эволюционные аспекты гонадотропин-рилизинг-гормона и его рецептора.Cell mol Neurobiology 15: 5-23, 1995

    53

    Cheng CK и Leung PC: Молекулярная биология рецепторов гонадотропин-рилизинг-гормона (GnRH) -I, GnRH-II и их рецепторов в людях. Endocr Rev 26: 283-306, 2005

    54

    Khosravi S, Leung PC: Дифференциальная регуляция гонадотропин-высвобождающего гормона (GnRH) I и GnRHII стероидных мессенджеров рибонуклеиновой кислоты человека гранулированные лютеиновые клетки.J Clin Endocrionol Metab 88: 663-672, 2003

    55

    Norwitz EF, Cardona GR, Jeong KH, Chin WW: Идентификация и характеристика гонадотропин-рилизинг-гормональных элементов ген рецептора гонадотропин-рилизинг-гормона мыши. J Biol Chem 274: 867-880, 1999

    56

    Yu B, Ruman J, Christman G: Роль периферических рецепторов гонадотропин-рилизинг-гормона в женской репродукции.Фертильность и стерильность 95: 465-473, 2011

    57

    Cheng CK и Leung PC: Молекулярная биология гонадотропин-рилизинг-гормона (GnRH) -I, GnRH-II и их рецепторов в людях. Endocr Rev 26: 283-306, 2005

    58

    Миллар Р.М., Лоу С., Конклин Д.А. и др.: Новый рецептор млекопитающих для эволюционно законсервированного гонадотропин-рилизинг-гормона II типа.Proc Natl Acad Sci USA 98: 9636-9641, 2001

    59

    Morgan K, Conklin D, Pawson AJ et al: трансрипционно-активный рецептор высвобождающего гена гонадотропина человека II типа перекрывает два гена в антисмысловой ориентации на хромосоме 1q.12. Endocrinology 144: 423-436, 2003

    60

    Cheung LWT, Wong AST: гонадотропин-рилизинг-гормон: передача сигналов рецептора GnRH во внегипофизарных тканях.FEBS Journal 275: 5479-5495, 2008

    61

    Hapgood JP, Sadie H, van Biljon W., Ronacher K: Регулирование экспрессии гормона, вызывающего рецептор гонадотропина генормона млекопитающих. Journal of Neuroendocrionology 17: 619-638, 2005

    62

    Singh P, Krishna A, Sridaran R, Tsutsui K: Иммуногистохимическая локализация GnRH и RF-амида в яичниках мышей во время эстрального цикла.J Mol Histol 42: 371-81, 2011

    63

    Chakrabarti N, Subbarao T, Sengupta A, Xu F, Stouffer RL, Sridaran R: Экспрессия мРНК I и белков Gn и II и их рецепторы в желтом теле приматов во время менструального цикла. Mol Reprod Dev 75: 1567-1577, 2008 г.

    64

    Скиннер, округ Колумбия, Альбертсон А.Дж., Навратил А., Смит А., Миньот М., Талботт Н., Сканлан-Блейк Н.: Эффекты гонадотропин-высвобождающего гормона репродуктивной системы за пределами гипота. ось.J Neuroendocrinol 21: 282-292, 2009

    65

    Chabre O et al: Связывание альфа 2A-адренергического рецептора с множеством G-белков. Простой подход для оценки эффективности связывания рецептор-G-белок в системе временной экспрессии. J Biol Chem 269: 5730-5734, 1994

    66

    Vrecl M et al: Кинетика интернализации рецептора гонадотропин-рилизинг-гормона (GnRH).Pflugers Arch 439 (3 Suppl): R19-R20, 2000

    67

    Choi SG, Jia J, Pfeffer RL, Sealfon SC: G-белки и аутокринная передача сигналов по-разному регулируют экспрессию гонитона. гонадотроп гипофиза. J Biol Chem (Epub перед печатью), 2012

    68

    Armstrong SP, Caunt CJ, Fowkes RC, Tsaneva-Atanasova K, McArdle CA: пульсирующий и устойчивый гонадотропин ( Передача сигналов рецептора GnRH: декодирует ли сигнальный путь Ca2 + / NFAT частоту импульсов GnRH? J Biol Chem 284: 35746-35757, 2009

    69

    Imai A, Horibe S, Takagi A, Tamaya T: Активация Gi-белком гонадотропин-рилизинг-гормона-опосредованного дефицита белка. рак эндометрия.Am J Obstet Gynecol 176: 371-376, 1997

    70

    Maiti K, Oh DY, Moon JS, Acharjee S, Li JH, Bai DG, Park HS, Lee K, Lee YC, Jung NC, Kim K, Vaudry H, Kwon HB, Seong JY: Дифференциальные эффекты гонадотропин-рилизинг-гормона (GnRH) -I и GnRH-II на передачу сигналов и гибель клеток рака простаты. J Clin Endocrinol Metab 90: 4287-4298, 2005

    71

    Everest HM, Hislop JN, Harding T et al: Сигнальные и антипролиферативные эффекты, опосредуемые рецепторами экспрессии GnRH в грудных клетках Использование рекомбинантного аденовируса.Endocrinology 142: 4663-4672, 2001

    72

    Kaiser UB, Sabbagh E, Katzenellenbogen RA, Conn PM, Chin WW: Механизм дифференциальной регуляции экспрессии гонадотропина субъединицей гонадотропина — высвобождающий гормон. Proc Natl Acad Sci USA 19; 92 26: 12280-12284, 1995

    73

    Nathwani PS, Kang SK, Cheng KW, et al: Регулирование гонадотропин-высвобождающего гормона (GnRH) и экспрессия его гена рецептора 17β-эстрадиолом в культивируемых гранулозно-лютеиновых клетках человека.Эндокринология 141: 1754-1763, 2000

    74

    An BS, Choi JH, Choi KC, Leung PC: Дифференциальная роль изоформ рецептора прогестерона в регуляции транскрипции гонадотропина гонадотропина человека Рецептор I (GnRH I), GnRH I и GnRH I. J Clin Endocrinol Metab 90: 1106-1113, 2005

    75

    Maya-Nunez G, Conn PM: регуляция транскрипции ген рецептора GnRH глюкокортоидами.Mol Cell Endocrinol 200: 89-98, 2003

    76

    Oakley AE, Breen KM, Clarke IJ, Karsch FJ, Wagenmaker ER, Tilbrook гормоны AJ: кортизинг-рилизинг гормона снижает частоту пульса. в фолликулярной фазе овцы: влияние яичниковых стероидов. Endocrinology 150: 341-349, 2009

    77

    Грегори SJ, Kaiser UB: Регулирование гонадотропинов ингибином и активином.Semin Reprod Med 22: 253-267, 2004

    78

    Winters SJ, Moore, Jr. JP: PACAP, аутокринный / паракринный регулятор гонадотрофов. Biol Reprod 84: 844-850, 2011

    79

    Сперофф Л., Фриц М.А.: Клиническая гинекологическая эндокринология и бесплодие, седьмое издание, глава 5, 2005 г. 8

    Raivio T, Falardeau J, Dwyer A, Quinton R et at: Обращение идиопатического гипогонадотропного гипогонадизма.N Engl J Med 357: 863-873, 2007

    81

    Broekmans FJ: Агонисты ГнРГ и лейомиомы матки. Репродукция человека 11: 3-25, 1996

    82

    Carr BR, Marshburn PB, Weatherall PT et al: Оценка влияния аналогов гонадотропин-высвобождающего гормона и медроксипрогестерона ацетата объем лейомиомы по данным магнитно-резонансной томографии: проспективное рандомизированное двойное слепое плацебо-контролируемое перекрестное исследование.J Clin Endocrinol Metab 76: 1217, 1993

    83

    Cann CE, Martin MC, Genant HK et al: Снижение содержания минералов в позвоночнике у женщин с аменореей. JAMA 251: 626, 1984

    84

    Matta WH, Shaw RW, Hesp R et al: Обратимая потеря плотности трабекулярной кости после индуцированного гипоэстрогенизма с помощью аналога GnRH бузерелина у женщин в пременопаралине.Clin Endocrinol (Oxf) 29:45, 1988

    85

    Тан О, Букулмез О: Биохимия, молекулярная биология и клеточная биология антагонистов гонадотропин-рилизинг гормона. Curr Opin Obstet Gynecol 23: 238-244, 2011

    86

    Del Mastro L, Boni L, Michelotti A, Gamucci T et al: Влияние гормона на триптоинтропный аналог гормона возникновение вызванной химиотерапией ранней менопаузы у женщин в пременопаузе с раком груди: рандомизированное исследование.JAMA 306: 269-276, 2011

    87

    Баласубраманиан Р., Дуайер А., Семинара С.Б., Питтелуд Н., Кайзер У.Б., Кроули В.Ф. Младший: модель уникальной болезни человеческого ГнРГ. чтобы разгадать онтогенез нейронов ГнРГ. Нейроэндокринология 92: 81-99, 2010

    88

    Dode C, Hardelin JP: Клиническая генетика синдрома Каллмана. Ann Endocrinol (Paris) 71: 149-157, 2010

    89

    Bianco SD, Kaiser UB: Генетические и молекулярные основы идиопатического гипогонадотропного гипогонадизма.Nat Rev Endocrinol 5: 569-576, 2009

    90

    Kaplan JD, Bernstein JA, Kwan A, Hudgins L: ключи к ранней диагностике синдрома Каллмана. Am J Med Genet A 152: 2796-2801, 2010

    91

    Villanueva C, de Roux N: мутации FGFR1 при синдроме Каллмана. Front Horm Res 39: 51-61, 2010

    92

    Brioude F, Bouvattier CE, Lombes M: Hypogonadotropic hypogonadism: новые аспекты в регуляции аксиально-гофрально-гипофиза.Ann Endocrinol (Paris) 71 (Suppl 1): S33-41, 2010

    93

    Martin C, Balasubramanian R, Dwyer AA, Au MG, Sidis Y, Kaiser UB, Seminara SB , Pitteloud N, Zhou QY, Crowley WF Jr .: Роль пути прокинетицина 2 в репродукции человека: данные исследования мутаций генов человека и мыши. Endocr Rev 32: 225-246, 2011

    94

    Bergman JE, Janssen N, Hoefsloot LH, Jongmans MC, Hofstra RM, van Ravenswaaij-Arts CM: CHARD7 мутации клинические последствия расширяющегося фенотипа.J Med Genet 48: 334-342, 2011

    95

    Xu N, Bhagavath B, Kim HG, Halvorson L et al: NELF представляет собой ядерный белок, участвующий в миграции нейронов гипоталамуса GnRH. Mol Cell Endocrionol 319: 47-55, 2010

    96

    Hwang JS: Гены, связанные с зависимым от гонадотропин-рилизинг-гормоном преждевременным половым созреванием. Korean J Pediatr 55: 6-10, 2012

    97

    Беате К., Джозеф Н., де Николас Р., Вольфрам К. Генетика изолированного гипогонадотропного гипогонадизма: роль рецептора генов RH и других .Int J Endocrinol, 2012

    98

    Topaloglu AK, Reimann F, Guclu M и др.: Мутации TAC3 и TACR3 в семейном гипогонадотропном гипогонадуроизме выявляют ключевую роль в контроле центрального гипогонадуроризма. репродукции. Nat Genet 41: 354-358, 2009

    99

    Bianco SDC, Kaiser UB: Генетические и молекулярные основы идиопатического гипогонадотропного гипогонадизма.Endocrinology 5: 569-576, 2009

    100

    Kim HG, Pedersen-White J, Bhagavath B, Layman LC: Генотип и фенотип пациентов с мутациями рецепторов гонадотропного гормона. Front Horm Res 39: 94-110, 2010

    Регуляция экспрессии гена гонадотропина с помощью вещества, ингибирующего Мюллеров

    Abstract

    Помимо своей роли в возникновении регрессии Мюллерова протока, Вещество, ингибирующее Мюллера (MIS), участвует в регуляции стероидогенез, рост груди и простаты и рекрутирование фолликулов яичников, все из которых являются процессами, контролируемыми или находящимися под влиянием гипоталамо-гипофизарно-гонадная ось.В то время как прямое влияние MIS на клетках гонад, предстательной железы и молочной железы находится в стадии исследования, способность MIS для модуляции функции гипофиза, тем самым влияя на эти ткани косвенно еще не изучен. Используя клетки LβT2, мышиный линии клеток, полученных из гонадотропов, мы оценили влияние MIS на экспрессия генов гонадотропинов. Мы показываем, что как клетки LβT2, так и Гипитарии взрослых крыс экспрессируют мРНК рецептора MIS типа II (MISRII). В течение 2 часов, Уровни мРНК β-субъединицы фолликулостимулирующего гормона (FSHβ) составляют значительно индуцируется добавлением MIS к клеткам LβT2 и остается повышен через 8 ч лечения.Активация транскрипции как Промоторы гена субъединицы β лютеинизирующего гормона (LHβ) FSHβ и лютеинизирующего гормона наблюдается с помощью MIS, что усиливает действие гонадотропин-рилизинг-гормона (GnRH) агонист на промоторе гена FSHβ и синергетический с GnRH агонист для стимуляции активности промотора гена LHβ. Дополнение MIS к Клетки LβT2 стимулируют активность промотора гена LHβ крысы с помощью всего 1 мкг / мл и дозозависимым образом. Эти исследования сообщают как экспрессия MISRII в клетках гипофиза крысы, так и в клетках, полученных из гонадотропов линия и MIS-опосредованная активация экспрессии генов LHβ и FSHβ, и предположить, что MIS может модулировать гипоталамо-гипофизарно-гонадная ось более чем на одном уровне.

    Мюллерово ингибирующее вещество [MIS, также известное как антимюллерово гормон или АМГ (1)] является гликопротеиновый гормон, член трансформирующего фактора роста β (TGFβ) факторов роста и дифференцировки и хорошо известно его роль в регрессе мюллерова протоков. Обычно, если эмбрион 46XY, бипотенциальные гонады участвуют в развитии семенников, и MIS начинает изменяться. экспрессируется путем дифференциации клеток Сертоли, что приводит к регрессии Мюллеровы протоки через 7-10 недель у человека и 13-17 дней у человека. грызуны во время эмбрионального развития самцов.В отсутствие MIS Мюллеровы протоки дифференцируются в женские внутренние репродуктивные органы: матка, маточные трубы и верхняя часть влагалища (см. 2).

    MIS продолжает экспрессироваться у самцов после Мюллерова протока регрессии и сохраняется на высоком уровне даже после рождения до полового созревания, с уровни обратно коррелировали с увеличением сывороточного тестостерона. Самки начинают экспрессировать низкие уровни MIS в клетках гранулезы яичников после рождения и достигают тех же уровней в сыворотке, что и у мальчиков в постпубертатном периоде.Последние исследования предполагают, что может быть несколько аспектов, имеющих физиологическое значение для продолжение экспрессии MIS, включая эффекты на стероидогенез гонад (3), набор фолликулов (4, 5) и угнетение простаты и пролиферация клеток груди (6, 7).

    Самцы мышей со сверхэкспрессией MIS имеют пониженные уровни тестостерона и Лейдига. гипоплазия клеток и часто недовирилизованы (8). И наоборот, мыши с нулевым значением мутации в MIS или рецепторе MIS типа II (MISRII) имеют клетки Лейдига гиперплазия (9, 10).Действительно, клетки Лейдига экспрессируют MISRII, а MIS напрямую подавляет выработку тестостерона клетками Лейдига, по крайней мере, частично за счет ингибирования экспрессии одного или нескольких из стероидогенные ферменты (11–14). MIS и MISRII экспрессируются в клетках гранулезы развивающихся фолликулов. (15–18), и роль MIS в функции гонад у женщин также была продемонстрировал. Помимо отсутствия внутреннего репродуктивного тракта, яичники самок трансгенных мышей, которые сверхэкспрессируют MIS, в значительной степени истощаются половых клеток к 2 неделям после рождения и не обнаруживаются у многих взрослых мыши (8, 11).Последующие исследования показали, что примордиальные фолликулы мышей, дефицитных по MIS, привлекаются к развиваются быстрее, чем у мышей дикого типа (5) и то добавление MIS к культивируемые яичники подавляют рост примордиальных фолликулов (4). Эти наблюдения предполагают что MIS играет важную роль в функции яичников, хотя точный механизмы еще предстоит выяснить.

    Функциональная ось гипоталамус-гипофиз-гонад также имеет решающее значение для репродуктивного развития и функции млекопитающих.Биосинтез и секреция лютеинизирующего гормона (ЛГ) и фолликулостимулирующего гормона (ФСГ) гипофизом строго контролируется в гипоталамо-гипофизарно-гонадная ось взаимосвязанной системой стимулирующие и тормозящие механизмы. Помимо основных ролей для гонадотропин-рилизинг-гормон (ГнРГ) и гонадные стероиды, некоторые представители Семейство TGFβ модулирует выработку гонадотропина. Среди них лучше всего охарактеризованы эффекты активинов и ингибинов. Активины и ингибины были впервые идентифицированы на основании их способности стимулировать и подавляют, соответственно, высвобождение гипофизарного ФСГ (19, 20).Последующие исследования выявили дополнительные важные физиологические роли этих факторов в гонадной функции, разработки и многие другие системы (см. 21 и 22). Увековеченная мышь клеточные линии, происходящие из гонадотропов гипофиза, αT3-1 и LβT2, были продемонстрировано, что экспрессирует рецепторы активина и реагирует на активин (23, 24). Совсем недавно кость было обнаружено, что морфогенетические белки (BMP) 6, 7 и 15 стимулируют ФСГβ. транскрипция гена и секреция ФСГ в клетках LβT2 и в первичных посевы гипофиза (25, 26).

    Помимо установленного воздействия на развитие и функцию гонад, были сообщения, указывающие на то, что MIS может иметь важные нормативные взаимодействия на уровне гипофиза (27, 28), который также может быть подтверждено исследованиями мышей со сверхэкспрессией MIS или дефицитом MIS или MISRII (Таблица 1). Уровни ФСГ в сыворотке были значительно ниже у 4-месячных взрослых женщин MIS нокаутные мыши по сравнению с контролем дикого типа (5). Другие исследования показали, что Двухмесячные трансгенные мыши-самцы со сверхэкспрессией MIS имели уровни сывороточного ЛГ и ФСГ повышен в 8 и 1 раз.В 5 раз больше, чем у соответствующие самцы мышей дикого типа (12). Хотя повышенный уровни согласуются с потерей подавления обратной связи снижением уровней эстрогенов и тестостерона, наблюдаемых у мышей со сверхэкспрессией MIS, они может также отражать прямое стимулирующее действие МИС на гипофиз. гонадотропы. В этих in vivo модели и вносят свой вклад в изменение уровней гонадотропинов.

    Таблица 1. Гормональные уровни у мышей T-MIS и MISKO

    Учитывая известные эффекты активинов и ингибинов на нескольких уровнях гипоталамо-гипофизарно-гонадная ось, а также по развитию, мы предположили, что MIS может иметь не менее важную регулирующую роль.Кроме того, продемонстрированные действия BMP на гонадотропную функцию, которые поделиться путями передачи сигнала с MIS (29–31), предположил, что гонадотропы также могут реагировать на MIS. К Чтобы проверить эту гипотезу, мы изучили влияние МИС на продукцию ФСГ и ЛГ. с использованием хорошо охарактеризованной клеточной линии, полученной из гонадотропов, LβT2 (32, 33).

    Материалы и методы

    Химикаты и реагенты. радионуклеотидов были приобретены у Перкин – Элмер.Все остальные химические вещества были получены от Sigma или Fisher. Научный, если не указано иное. Женский FCS был приобретен у Aires. Scientific / Biologos (Ричардсон, Техас). Рекомбинантный человеческий MIS был выражен в Клетки яичников китайского хомячка и секретируются в химически определенный бессывороточный media, как описано (34). ГнРГ агонист (дез-Gly 10 — [d-Ala 6 ] этиламид GnRH) был куплен у Сигмы.

    Клеточные культуры и исследования на животных. клеток LβT2 и αT3-1, щедрые дары Памелы Меллон (Калифорнийский университет в Сан-Диего, штат Луизиана) Jolla), культивировали в среде DMEM с высоким содержанием глюкозы (Invitrogen Life Technologies). содержащий 10% женской FCS и 1% смесь пенициллин-стрептомицин.Женский FCS был используется для предотвращения непреднамеренного воздействия на клетки MIS, который присутствует в сыворотка, полученная от бесполых плодных телят. Клетки инкубировали при 37 ° C в увлажненная атмосфера 5% CO 2 . РНК собирали из тканей Трехмесячные самцы и самки мышей или самцы и самки крыс весом 200 г (Charles River Селекционные лаборатории). Все исследования с участием животных проводились в в соответствии с установленными стандартами и утвержденными институциональным животным Комитет по уходу и использованию.

    Вестерн-блот, Нозерн-блот и количественная ПЦР в реальном времени (QRT) Анализирует. Вестерн-анализ проводили с поликлональным антителом. подготовлен против киназного домена крысиного MISRII, как описано (35). Для Нозерн-блоттинга Анализ, общая РНК была выделена с использованием TRIzol (Invitrogen). РНК (10 мкг) образцы денатурировали диметилсульфоксидом и глиоксалем при 65 ° C, разделены в 1,5% -ном агарозном геле, нанесены на нейлоновые мембраны в течение ночи и УФ-сшивка.Блоты были предварительно гибридизированы с лососем, обработанным ультразвуком 100 мкг / мл. ДНК сперматозоидов в 50% растворе для гибридизации формамида и гибридизовали в течение ночи при 65 ° C с 2 × 10 6 имп / мл / мл антисмыслового рибозонда против MISRII (14). Кляксы промывали при 65 ° C 0,1 × SSC / 0,1% SDS и подвергали воздействию рентгенографическая пленка с усиливающими экранами при –70 ° C. Кляксы были перепробован человеческим рибозондом β-актина (36) при 65 ° C и промывали при 65 ° C с 0,1 × SCC / 0,1% SDS.

    экспериментов QRT-PCR были выполнены в SmartCycler (Cepheid, Sunnyvale, CA) с использованием пар праймеров Lux, разработанных Invitrogen, для мышиного LHβ. (CACTTGCTGCTGCTGAGCCCAAG5G-FAM, TGCAGACTGGGCAGAACTCA) и мышиный ФСГβ (GACCGAGCCAGGCAATCTTACGG5C-FAM, CGGCCCAATACCCAGAAAGT) с реагентами из Платиновая количественная RT-PCR одностадийная система Thermoscript (Invitrogen Life Technologies) и 250 нг тотальной РНК.Реакция обратной транскриптазы была проводили в течение 30 мин при 55 ° C, а ПЦР проводили с 45 циклами при 95 ° C для 15 с, 55 ° C в течение 30 с и 72 ° C в течение 60 с. Относительная концентрация мРНК определяли путем вычисления разницы ( x ) в значение порогового цикла (Ct), которое затем интерпретируется как 2 x -кратная разница в концентрации матрицы. Крыса МИСРИИ был обнаружен с помощью обратной транскрипции-ПЦР, как указано выше, с праймерами Lux (CACATTCGAGACCTGAGCAGCCAGAATG5G-FAM, CAGGGAGTACCAAGGCAAGG), оба обратные транскрипция и отжиг проводят при 62 ° C.

    Люциферазные анализы. Используемые репортерные конструкции были созданы слияние –797 / + 5 гена LHβ крысы, –2000 / + 698 гена крысы Ген FSHβ, –846/0 субъединицы α гликопротеина человека (αGSU) и -1164 / + 62 гена рецептора GnRH мыши (GnRHR) к кДНК люциферазы светлячка в векторе pXP2, как описано (37–39). Клетки LβT2 временно трансфицировали электропорацией 2 мкг на лунку любой репортерной конструкции (αGSU-Luc, LHβ-Luc, FSHβ-Luc, GnRHR-Luc) или 2 мкг на лунку пустого вектора (pXP2) и 1 мкг на лунку вектора SV40-β-галактозидазы (любезно предоставлено Анни Ладу, Национальный институт Санте и исследований Медикаль, Тулуза, Франция).Затем клетки высевали в шестилуночный планшеты для тканевых культур с последующей инкубацией при 37 ° C в течение 48 ч с соответствующее лечение. Для временной трансфекции αT3-1 клетки подвергали разделены на шести-луночные планшеты для тканевых культур и культивированы в течение ночи в среде DMEM в отсутствие сыворотки или антибиотиков до 60–80%. Затем клетки αT3-1 трансфицировали соосаждением фосфатом кальция. (40) с 2 мкг на лунку либо LHβ-Luc, либо pXP2 в течение 24 часов в среде, содержащей 2% FBS, затем инкубация при соответствующем лечении.Для люциферазной активности измерения, клетки LβT2 и αT3-1 дважды промывали ледяной PBS и лизировали 125 мМ Tris · HCl / 0,5% Triton X-100. После центрифугирование при 14000 × g и 4 ° C, люцифераза и Активность β-галактозидазы измеряли в супернатантах. Люцифераза активность была нормализована для активности β-галактозидазы, чтобы исправить эффективность трансфекции. Изучить влияние МИС на базальную и GnRH-стимулированная активность субъединицы гонадотропина или промоторов гена GnRHR, трансфицированные клетки культивировали в течение 48 ч и стимулировали указанные концентрации MIS за последние 4 или 24 часа и / или 100 нМ GnRH агонист в течение оставшихся 4 ч.

    Статистический анализ. Все исследования репортера люциферазы, кроме исследование доза-ответ включало не менее трех независимых экспериментов, каждое выполнено в трех экземплярах. Результаты люциферазы были проанализированы односторонним ANOVA на повторных измерениях из репрезентативного эксперимента, за которым следует Апостериорный тест Тьюки – Крамера с помощью instat 3.0 (GraphPad, San Диего). Эксперименты QRT-PCR также были проанализированы не менее трех раз с репрезентативный эксперимент и были проанализированы апостериорным тестом Даннета с призма 3.0 (GraphPad). Значимость была присвоена с доверительной вероятностью 95%. ( P <0,05).

    Результаты

    Клетки LβT2 и гипофизы крыс экспрессируют MIS типа II Рецептор. Чтобы выяснить, может ли MIS действовать непосредственно на уровне гонадотропов гипофиза для регулирования производства ЛГ и ФСГ, мы сначала искали экспрессию MISRII в двух культурах клеток, полученных из гонадотропов мышей модельные системы, αT3-1 и LβT2 (Рис.1 A ). Северный блот-анализ с использованием РНК, собранной из клеток αT3-1 и LβT2, и использование полноразмерного антисмыслового рибозонда для крысиного MISRII показывает, что Клетки LβT2, но не клетки αT3-1, экспрессируют мРНК для MISRII.РНК из клеток αT3-1 не показывала экспрессию MISRII даже с 6-дневная выдержка пятна на пленке. На рис. 1 B , уровень мРНК MISRII в клетках LβT2 составлял по сравнению с семенниками, яичниками и клетками MA-10 мыши, мышь Leydig линия клеток опухоли, которую мы использовали для изучения ингибирования стероидогенеза пользователя MIS (41). После ночи экспозиции были обнаружены две полосы, меньшая из которых может быть укороченной вариант сращивания с неизвестной функцией (42). Выражение полноразмерный MISRII, по-видимому, выше в клетках LβT2, чем в MA-10 клеток, но ниже, чем в семенниках или яичниках.МРНК MISRII экспрессия в гипофиза взрослых крыс не наблюдалась по Нозерн-анализу. (данные не показаны), но было обнаружено с помощью обратной транскрипции-ПЦР с использованием РНК гипофиза, выделенная из взрослых самок крыс, в качестве матрицы (Рис.1 C ). МИСРИИ белок также был обнаружен в ткани гипофиза и семенниках крыс, но не в COS-7. клеток (отрицательный контроль), Вестерн-анализом с кроличьим поликлональным антитело, полученное против киназного домена рецептора (Рис.1 D ).

    Рис.1. Экспрессия мРНК и белка

    MISRII в клетках LβT2 и гипофизе крысы. В A и B , тотальную РНК подвергали Нозерн-блот-анализу, зондировали антисмысловым рибозондом крысы MISRII и перепроверяли Рибозонд β-актина для контроля нагрузки. ( A ) РНК из Клетки αT3-1 и клетки LβT2 анализировали, как указано. ( B ) РНК собирали из семенников и яичников мышей, а также из клеток MA-10 и Как указано, клетки LβT2. ( C ) Обратная транскрипция – ПЦР анализ РНК гипофиза МА-10 и взрослых самок крыс с праймерами для МИСРИИ.Стрелка указывает полосу MISRII ожидаемого размера. В немаркированная верхняя полоса соответствует неправильно нанесенному продукту MISRII. Обе группы были подтверждены секвенированием. ( D ) Вестерн-анализ белка из яичко и гипофиз взрослого мужчины и клетки COS с антителом к ​​MISRII киназный домен. Белок MISRII обозначен стрелкой.

    MIS увеличивает устойчивые уровни мРНК FSHβ в LβT2 Ячейки. Экспрессия MISRII в линии клеток гонадотропа LβT2 предположил, что MIS может влиять на функцию гонадотропа в целом, и на производство гонадотропинов, в частности.Затем мы оценили, добавление ли MIS в клетках может изменять устойчивый уровень FSHβ и LHβ. мРНК с помощью QRT-PCR. Сначала мы проанализировали мРНК ФСГβ и наблюдали, что добавление 5 мкг / мл (35 нМ) MIS значительно увеличился ( P <0,001) Уровни мРНК ФСГβ ≈10 раз в течение 2 часов (Рис.2 A ). В значительная индукция мРНК FSHβ с помощью MIS сохранялась в течение 8 часов. К 18 часам индукция ФСГβ с помощью MIS больше не отличалась значительно от индукции необработанных клеток, и уровни вернулись к исходному уровню через 30 часов.Эти самые РНК образцы также анализировали параллельно на экспрессию LHβ. (Рис.2 B ). Нет статистически значимая разница в уровнях мРНК LHβ наблюдалась с Дополнение MIS к ячейкам. Уровни мРНК FSHβ требовали шести циклов. больше мРНК LHβ для достижения порогового значения в QRT-PCR, что указывает на присутствие мРНК FSHβ в ≈64 раза меньше, чем мРНК LHβ в этих образцах при условии равной эффективности праймеров (не показаны).

    Рис.2.

    MIS регулирует уровни мРНК эндогенного FSHβ.Общая РНК была приготовлена ​​из Клетки LβT2 обрабатывали 35 нМ MIS в течение указанного времени. Равные суммы РНК подвергали комбинированной обратной транскрипции и QRT-PCR с праймеры, специфичные к FSHβ ( A ) и LHβ ( B ). В пороговые значения концентрации (Ct) не менее трех повторов усреднялись, и отличия от контроля были нанесены на график после нормализации значения Ct. разница от 1 до 2 раз. Значения представляют собой среднее значение ± стандартная ошибка среднего. * и ** представляют существенные различия P <0.05 и P <0,001, соответственно, по сравнению с необработанными (NT) контролирует.

    Влияние MIS на транскрипцию гена субъединицы гонадотропина. Кому определить, наблюдается ли эффект MIS на эндогенную мРНК FSHβ уровни могут возникать на уровне транскрипции, мы оценили эффекты добавлен MIS на промотор / люциферазу трансфицированного гена субъединицы гонадотропина крысы репортерская деятельность. Кроме того, мы изучили эффекты МИС в присутствии или отсутствие GnRH, главного регулятора транскрипции гена гонадотропина.Клетки LβT2 трансфицировали репортерными конструкциями (FSHβ-Luc, LHβ-Luc и αGSU-Luc) и стимулировали 35 нМ MIS в течение 4 или 24 часов. с или без 100 нМ агониста гонадолиберина в течение последних 4 часов. Время стимуляции 4 и 24 часа были выбраны потому, что стимуляция гена субъединицы гонадотропина Было показано, что репортеры промотора / люциферазы GnRH максимальны через 4 часа. (39) и поскольку оба активина и MIS воздействуют на клетки оптимально через 24 часа или около того. (23, 24, 41). Как показано в Рис. 3, обработка клеток трансфицированные FSHβ-Luc только с помощью MIS в течение 4 или 24 часов не имели значительное влияние на активность люциферазы (Инжир.3 А ). ГнРГ был способны стимулировать промотор FSHβ, на что указывает увеличение активность люциферазы после воздействия 100 нМ агониста GnRH в течение 4 часов. Кроме того, несмотря на отсутствие эффекта только от MIS, GnRH-стимулированные Активность промотора FSHβ была значительно увеличена ( P <0,05). в присутствии как агониста ГнРГ, так и МИС в течение 4 часов, но пропадал через 24 часа лечения МИС. Лечение MIS в течение 4 ч привело к увеличению базального Активность промотора LHβ, которая усиливалась в присутствии GnRH (Инжир.3 В ). Несмотря на то что повышенная активность промотора LHβ в отсутствие GnRH все еще наблюдалась после 24 часов лечения MIS синергизм с GnRH в это время был утрачен точка. Принимая во внимание, что лечение гонадолиберином увеличивало активность αGSU-Luc в 15 раз, MIS не оказывал значительного влияния ни на базальную, ни на GnRH-стимулированную αGSU. активность промотора гена (рис. 3 С ). Ни MIS, ни GnRH не оказали значительного влияния на активность вектора без промотора, pXP2, который использовали в качестве отрицательного контроль (не показан).

    Рис.3.

    Влияние MIS на активность промотора гена субъединицы гонадотропина. Люцифераза активность измеряли в клетках LβT2, временно трансфицированных SV40-β-галактозидаза и FSHβ-Luc ( A ), LHβ-Luc ( B ) и αGSU-Luc ( C ). Клетки стимулировали в течение 4 или 24 часа с 35 нМ MIS с или без агониста GnRH 100 нМ в течение последних 4 часов. Активность люциферазы нормировали на активность β-галактозидазы, и результаты выражаются в условных световых единицах (ALU).Точки данных представляют среднее значение ± стандартная ошибка среднего для репрезентативного эксперимента, проведенного в трех экземплярах. * представляет собой значительную разницу P <0,05 между указанные группы.

    Изучить, может ли MIS оказывать влияние на FSHβ и LHβ экспрессия гена косвенно, влияя на экспрессию GnRHR, клетки также были трансфицированы GnRHR-Luc и впоследствии обработаны MIS. Статистически нет значительный эффект MIS либо на базальный, либо на GnRH-стимулированный GnRHR-Luc был наблюдается (не показано).Мы также оценили влияние MIS на активацию промотора гена LHβ в клетках αT3-1, которые не экспрессируют МИСРИИ (рис. 1). Это было сделано чтобы гарантировать, что эффекты MIS на клетки LβT2 не были вызваны неспецифический механизм; например, связывание с другими трансформирующими ростками рецепторы семейства фактора β (TGFβ). Нет значительного индукции Экспрессия гена LHβ наблюдалась в этой клеточной линии (не показана).

    MIS стимулирует активность промотора гена LHβ в зависимости от дозы Манера. Мы обычно используем 5 мкг / мл (35 нМ) MIS в наших экспериментах, чтобы наблюдать полную регрессию Мюллерова протока в органной культуре (34) но также наблюдали другие эффекты MIS при более низких концентрациях (41). Поскольку анализ ответ на MIS с GnRH показал, что MIS может увеличивать как базальную, так и GnRH-стимулированная активность промотора гена LHβ, доза-ответ проведен эксперимент с МИС при наличии или отсутствии ГнРГ. (Рис.4). Клетки LβT2 были трансфицировали LHβ-Luc и стимулировали в течение 4 ч с увеличением концентрации MIS в присутствии или в отсутствие агониста GnRH.А концентрация всего 1 мкг / мл MIS была достаточной для стимуляции LHβ активность промотора значительно ( P <0,05), что в дальнейшем увеличился на 5 и 20 мкг / мл MIS ( P <0,01). В отсутствие MIS, агонист GnRH был способен индуцировать 4,2-кратное увеличение люциферазы деятельность. При одновременном добавлении MIS могла увеличивать Дальнейший ответ, стимулированный ГнРГ, снова со значительным эффектом МИС начиная с концентрации 1 мкг / мл. Добавление 20 мкг / мл MIS с или без GnRH, повышенная активность промотора LHβ ≈2 раза по сравнению с клетки, которые не обрабатывались MIS.

    Рис.4.

    MIS стимулирует LHβ-Luc дозозависимым образом. Люциферазная активность измеряли в клетках LβT2, временно трансфицированных LHβ-Luc, и SV40-β-галактозидаза. Через сорок четыре часа после трансфекции клетки были стимулировали в течение 4 часов с увеличением концентрации только MIS (заполнены кружки) или в комбинации со 100 нМ агонистом гонадолиберина (белые кружки). Люцифераза активность была нормализована для β-галактозидазы, и результаты выражены как условные световые единицы (АЛУ). Точки данных представляют собой среднее значение ± SEM трех реплицирует. * и ** представляют собой значительное увеличение P <0,05 и P <0,01, соответственно, от предыдущей точки на заданная кривая.

    Обсуждение

    Мы показали, что мРНК и белок MISRII экспрессируются у крыс. гипофиз и клетки LβT2, иммортализованные мышиные гонадотропные линия клеток гипофиза также экспрессирует мРНК MISRII, что позволяет предположить, что гонадотропы может реагировать на MIS. Действительно, добавление MIS к клеткам LβT2 приводит к многократному увеличению мРНК эндогенного ФСГβ и активации активности люциферазы, управляемой промотором FSHβ и LHβ, поддерживая роль МИС в регуляции выработки гонадотропинов.Дальнейшие исследования эффекты MIS в первичной культуре клеток гипофиза будут необходимы для подтвердите эти наблюдения после тщательной характеристики развития экспрессия MISRII в гипофизе и определение оптимального время и концентрация MIS необходимы.

    MISRII был обнаружен с помощью in situ гибридизации в передний гипофиз эмбриональных и новорожденных мышей обоего пола (D. Pfaff, D. Т. Маклафлин и П. К. Донахью, личное сообщение), предполагая, что MIS также может влиять на активность или развитие гипофиза в сексуально диморфным образом (поскольку высокий уровень МИС сыворотки у мужчин контрастирует с отсутствием поддающихся обнаружению MIS у самок на этих стадиях развития. этапы).Перинатальная экспрессия MISRII в гипофизе также хорошо коррелирует. с нашими исследованиями на клетках LβT2, которые обладают чертами мышиных гонадотропы гипофиза, полученные с 17.5-го дня эмбрионального развития. Отсутствие МИСРИИ экспрессия в клетках αT3-1 (рис. A ), которые имеют характеристики гонадотропов, производных с 13,5 дня эмбрионального развития (33), также согласуется с периодом развития действия MIS на гонадотроп функция.

    Вероятно, МИС действует как эндокринный гормон.Один из первых Признаками существования MIS было наблюдение, что телочки анастомозирующие гетеросексуальные близнецы часто не имели производных мюллерова протока, явление, известное как эффект Freemartin (43). Как и в случае с активинами (44) и морфогенетические белки (BMP) (25), один можно также предположить, что MIS производится локально гипофизом или гипоталамус, тем самым увеличивая его локальную концентрацию и предлагая аутокринный или паракринный эффект. Эта возможность еще предстоит изучить.

    В исследованиях QRT-PCR MIS оказала наибольшее влияние на установившееся состояние уровни мРНК FSHβ, но не оказали заметного влияния на LHβ (Рис. 2), открытие, что по-видимому, противоречит результатам промотора генов FSHβ и LHβ исследования (рис. 3). Этот Расхождение можно объяснить относительными периодами полураспада и концентрацией две мРНК. В то время как мРНК LHβ имеет длительный период полужизни, FSHβ мРНК быстро оборачивается (45), что делает его устойчивый уровень более поддается манипуляциям даже относительно скромными увеличивает транскрипцию.Кроме того, уровень мРНК LHβ в Клетки LβT2 настолько выше, чем мРНК FSHβ, что индукция его транскрипцию с помощью MIS легче наблюдать с помощью репортерных анализов, чем изменением его стационарного уровня. В качестве альтернативы, MIS может регулировать стабильность мРНК мРНК FSHβ, которая не будет обнаружена в репортерные анализы. Тривиальное объяснение может заключаться в том, что ген FSHβ фрагмент промотора в конструкции репортера люциферазы не включает Элементы ДНК, необходимые для экспрессии, регулируемой MIS.Разгадывая точный молекулярные механизмы, участвующие в экспрессии гонадотропина, регулируемой MIS, должны стимулировать увлекательные долгосрочные исследования и будет иметь жизненно важное значение для нашего понимания роль MIS играет в функции и / или развитии гипофиза.

    Более ранние исследования показали, что иммунологическая блокада действия гонадолиберина. пренатально привел к увеличению послеродового производства белка MIS, как измерено биоактивностью в анализе органной культуры и этой заменой ФСГ, но не ЛГ, восстановил нормальный уровень экспрессии MIS (27, 46).Кроме того, пренатальный обработка ФСГ снижала экспрессию MIS при оценке с помощью иммуногистохимия, а также (28), хотя недавний отчет предполагает иное постнатально (47). Эти результаты, когда в сочетании с нашими текущими наблюдениями, соблазняют нас предположить, что петля ауторегуляторной обратной связи существует между гипофизом, где MIS увеличивается Экспрессия ФСГ и гонады, где ФСГ снижает экспрессию MIS. Это также возможно, что MIS может модулировать другие гены-мишени в гонадотропах, которые у нас есть еще не изучены, или другие процессы, такие как рост клеток, дифференциация или оборот.

    С учетом того, что постнатальная экспрессия MIS может иметь физиологические Значение, изучение MIS вступило в захватывающую новую эру. В добавление к способность MIS ингибировать стероидогенез и нашу текущую гипотезу о том, что он также может регулировать функцию гонадотропов, недавние сообщения о том, что MIS может подавлять рост и распространение клеток рака груди, простаты и яичников предвещают светлое будущее научных исследований для этого до сих пор скромного гормон.

    Благодарности

    Мы благодарим Dr.Памела Меллон для клеток LβT2 и αT3 и доктора. Натали ди Клементе, Патрисия К. Донахью и Дэвид Т. Маклафлин для предоставление неопубликованной информации. Мы также благодарим докторов наук. Патрисия К. Донахью, Алану Шнейеру и Тренту Р. Кларку за рецензирование рукописи, Дэвиду Т. Маклафлину за MIS и Тхань Ха за помощь с западным анализом. Этот Работа поддержана Национальным институтом здоровья ребенка и человека. Развитие (NICHD) / Национальные институты здравоохранения через кооператив Соглашение U54 HD28138 в рамках Программы специализированных кооперативных центров в исследованиях репродукции (У.Б.К. и J.T.), грант Национального института рака R29-CA79459 (для J.T.), Грант NICHD R01-HD33001 (для U.B.K.), The Lalor Фонд (G.Y.B.), Программа развития ученых-репродуктологов K12-HD00840 через Ассоциацию профессоров акушеров и гинекологов и Национальные институты здоровья (E.R.N.) и репродуктивного здоровья женщин Премия за исследования K12-HD01255 (E.R.N.).

    Сноски

    • ↵§ Кому следует обращаться по адресу: Pediatric Surgical Research Лаборатории, 32 Fruit Street, Бостон, Массачусетс 02114.Эл. адрес: teixeira {at} helix.mgh.harvard.edu.

    • Сокращения: MIS, Мюллерово ингибирующее вещество; МИСРИИ, тип МИС Рецептор II; ЛГ, лютеинизирующий гормон; ФСГ, фолликулостимулирующий гормон; ГнРГ, гонадотропин-рилизинг-гормон; GnRHR, рецептор GnRH; αGSU, гликопротеин субъединица α; QRT, количественный анализ в реальном времени.

    • Поступила 17 февраля 2003 г.
    • Copyright © 2003, Национальная Академия Sciences

    Антагонисты гонадотропин-высвобождающего гормона при раке простаты

    Андрогенная депривация (ADT) проводится в нескольких формах, таких как хирургическая кастрация или медицинская кастрация с использованием агонистов гонадотропин-высвобождающего гормона (GnRH) или терапия антагонистами GnRH.ADT — это критически важный метод лечения метастатического рака простаты с высоким риском. Между агонистами и антагонистами гонадолиберина существуют важные различия. Здесь мы рассматриваем механизм действия агонистов и антагонистов ГнРГ, а также исследования, которые привели к одобрению дегареликса. Мы также комментируем потенциальные риски и преимущества дегареликса, особенно когда речь идет о здоровье сердечно-сосудистой системы. Наконец, мы описываем пероральный антагонист ГнРГ, который в настоящее время не используется при раке простаты, но включен для полноты картины.

    Введение

    Рак предстательной железы является третьей по значимости причиной смерти от рака в Соединенных Штатах и ​​составляет одну пятую всех новых диагнозов рака. [1] Андрогенная депривационная терапия (ADT) является основой лечения пациентов с распространенным раком простаты и показана для использования в различных клинических условиях рака простаты. Химическая кастрация состоит из агонистов и антагонистов гонадотропин-рилизинг-гормона (GnRH), вводимых внутримышечно, подкожно или перорально.Примечательно, что гонадолиберин иногда называют рилизинг-гормоном лютеинизирующего гормона (ЛГРГ). Обычно используемым ADT является ацетат лейпролида, агонист гонадолиберина, который был одобрен для лечения распространенного рака простаты в 1985 году [2]. Гозерелин, другой агонист ГнРГ, был одобрен в 1996 году. Одной из основных проблем при использовании агонистов ГнРГ является всплеск тестостерона, вызванный первоначальным действием препарата на гипофиз. Этот всплеск тестостерона может привести к обострению опухоли, быстрому распространению рака простаты, что приведет к боли и потенциальному истощению у пациентов, особенно с метастазами в позвоночник.Это явление привело к тому, что эксперты по раку простаты потребовали одновременного применения антиандрогена, например, бикалутамида, в течение первого месяца лечения агонистом гонадолиберина, поскольку было обнаружено, что антиандрогены отменяют выброс тестостерона. Эта обеспокоенность обострением опухоли привела к развитию антагонистов гонадолиберина, которые не вызывают выброс тестостерона, поскольку лекарство не стимулирует гипофиз. Антагонист ГнРГ дегареликс в настоящее время одобрен Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) для лечения пациентов с распространенным раком простаты.[3] Abarelix, другой антагонист GnRH, показал клинические перспективы, но был снят с продажи из-за побочных эффектов. Relugolix — пероральный антагонист GnRH, который в настоящее время разрабатывается для лечения рака простаты в клинических испытаниях. Здесь мы рассматриваем дегареликс и релуголикс, их эффективность и безопасность при лечении рака простаты.

    Механизм действия

    Дегареликс и абареликс являются инъекционными антагонистами ГнРГ, и релуголикс принимают перорально. Все они связываются с рецептором гонадолиберина в передней доле гипофиза.Они являются аналогами GnRH и действуют как конкурентный ингибитор GnRH. [4] ГнРГ опосредует стимуляцию секреции гонадотропина (т.е. фолликулостимулирующего гормона [ФСГ] и лютеинизирующего гормона [ЛГ]). В отличие от агонистов ГнРГ, антагонисты ГнРГ не вызывают первоначального выброса гонадотропинов. Они быстро снижают секрецию ЛГ и ФСГ гипофизом, что приводит к немедленному снижению секреции тестостерона клетками Лейдига яичек. [5-7]

    FDA одобрило введение дегареликса подкожно в качестве начальной дозы 240 мг. доза, с последующим введением 80 мг каждые 28 дней.Период полувыведения начальной дозы составляет 43 дня, а для поддерживающей — 28 дней.

    Дегареликс: эффективность

    Основное испытание, которое в конечном итоге привело к одобрению дегареликса, было опубликовано Клотцем и др. В 2008 году. Это испытание, именуемое здесь «CS21», было рандомизированным испытанием фазы III, сравнивающим стандартные — леупролида ацетат по сравнению с дегареликсом. Пациенты со всеми стадиями рака простаты были рандомизированы в соотношении 1: 1: 1 для приема 240 мг дегареликса с последующим ежемесячным поддерживающим дозированием 80 или 160 мг или для приема ацетата лейпролида 7.5 мг в месяц. Первичная конечная точка была определена как снижение уровня тестостерона до <50 нг / дл между 28 и 364 днями, что было достигнуто у> 96% пациентов во всех группах. В качестве вторичной конечной точки клиническое испытание также показало, что дегареликс превосходит лейпролид в снижении уровня тестостерона до <50 нг / дл в течение 3 дней после первоначального лечения у> 90% пациентов. Реакции в месте инъекции были более частыми в группе, получавшей дегареликс, но инфекции мочевыводящих путей были уменьшены в группе дегареликса; частота всех других нежелательных явлений существенно не различалась.Интересно, что 22 из 202 пациентов (11%), получавших ацетат лейпролида, также получали бикалутамид во время первоначального введения для защиты от обострения опухоли. При анализе подгрупп у пациентов, которые одновременно принимали бикалутамид и лейпролид, наблюдалось быстрое снижение уровня простат-специфического антигена (ПСА), как и у пациентов, получавших дегареликс. [8] Поскольку первичная конечная точка не меньшей эффективности была достигнута, это клиническое испытание в конечном итоге привело к одобрению дегареликса в дозе 240 мг / 80 мг для лечения пациентов с раком простаты в качестве альтернативы ацетату лейпролида.

    CS21 привел к дальнейшим анализам подгрупп, в каждом из которых была предпринята попытка оценить эффективность дегареликса по сравнению с ацетатом лейпролида. На основании этих анализов выяснилось, что дегареликс превосходит лейпролид в отношении рецидивов ПСА или смерти через 1 год, быстрее снижает уровень тестостерона до уровня кастрации и более эффективен в снижении щелочной фосфатазы у пациентов с метастазами в кости. [ 9-11] Запланированным анализом была только выживаемость без прогрессирования ПСА. В одном из таких подмножеств анализа была предпринята попытка изучить концепцию «микроимпульса тестостерона», то есть всплеска тестостерона, возникающего после продолжительной терапии агонистами гонадолиберина.Они исследовали уровни тестостерона на 252-й, 255-й и 259-й дни, пытаясь увидеть, был ли рост тестостерона после лечения в течение 252 дней. Они обнаружили, что после приема девятой дозы ацетата лейпролида или дегареликса на 252 день наблюдалось повышение уровня тестостерона у пациентов, получавших ацетат лейпролида ( P <0,001). Увеличение среднего изменения тестостерона на 0,018, 0,040 и 0,054 нг / мл наблюдалось при исходном уровне тестостерона <3.5, 3,5–5,0 и> 5,0 нг / мл соответственно у пациентов, получавших лейпролид, тогда как для дегареликса среднее изменение было отрицательным [10]. Это говорит о том, что даже после первого месяца терапии при последующем дозировании ацетата лейпролида происходит всплеск тестостерона. Однако неизвестно, является ли это увеличение клинически значимым.

    Безопасность, переносимость и долгосрочная эффективность изучались в расширенном исследовании, которое продолжалось на той же популяции пациентов, что и CS21. Пациенты, завершившие 1 год терапии CS21, либо продолжали принимать дегареликс в той же поддерживающей дозе, к которой они были рандомизированы, либо, если они получали ацетат лейпролида, они были рандомизированы для приема дегареликса в дозе 240 мг с последующим приемом 160 мг. или 80 мг обслуживания в общей сложности 5 лет.После среднего периода наблюдения 27,5 месяцев у пациентов, которые перешли с лейпролида ацетата на дегареликс, наблюдалось статистически значимое снижение выживаемости без прогрессирования ПСА в первый год по сравнению с каждым последующим годом. Частота связанных с лечением нежелательных явлений была одинаковой в трех группах. [12] При 5-летнем анализе исследования наиболее частым нежелательным явлением снова были реакции в месте инъекции при первоначальной инъекции по сравнению с последующими инъекциями (31% и 2,5% соответственно).Сорок два процента пациентов завершили 5-летнее исследование; прекращение приема препарата не считалось связанным с исследуемым лечением, но авторы не вдавались в подробности [13].

    Дегареликс: симптомы нижних мочевыводящих путей и международная оценка симптомов простаты

    Клинически значимый исход симптомов нижних мочевыводящих путей (СНМП) был впервые оценен в рандомизированном исследовании, сравнивающем дегареликс с гозерелином плюс бикалутамид у пациентов, получающих АДТ, с конечной точкой уменьшение общего объема простаты (TPV).Они рандомизировали 182 пациента в соотношении 1: 1 для лечения дегареликсом и гозерелином в течение 12 недель. Пациенты, получавшие гозерелин, также получали бикалутамид в течение первых 28 дней, чтобы предотвратить вспышку тестостерона. Они обнаружили, что дегареликс не уступал гозерелину плюс бикалутамиду по снижению ОЦП (-37,2% против -39,0%). Они также обнаружили, что пациенты, получавшие дегареликс, в большей степени облегчили свои СНМП, как это определено Международной шкалой симптомов простаты (IPSS). Также наблюдалась тенденция к улучшению качества жизни пациентов, получавших дегареликс, но эта тенденция не была значительной.[14]

    TPV также было изучено в условиях неоадъювантной терапии, и было обнаружено, что дегареликс не уступает гозерелину плюс бикалутамид в снижении TPV до радикальной лучевой терапии при локализованном заболевании. Важно отметить, что неоадъювантная АДТ не является стандартом лечения. В этом исследовании дегареликс снова оказался более эффективным при снижении баллов по шкале IPSS. Кроме того, это одно из немногих клинических испытаний, в которых проспективно оценивается эффективность антагониста GnRH по сравнению с агонистом GnRH плюс антиандроген с точки зрения снижения уровня тестостерона.Хотя это не было заранее определенной конечной точкой, исследователи отметили, что не было никакой разницы в средних уровнях тестостерона на 4, 8 и 12 неделе в обеих группах. [15] Объединив три рандомизированных исследования фазы III [14–16], объединенный анализ, опубликованный в 2015 году, показал, что дегареликс значительно лучше снижал баллы IPSS по сравнению с гозерелином через 12 недель. И снова не было замечено никаких различий в снижении TPV или побочных эффектах, связанных с инфекцией мочевыводящих путей [17].

    Degarelix: объединение и мета-анализ

    С тех пор были выполнены два крупных метаанализа и объединенного анализа, генерирующего гипотезы.В одном объединенном анализе были рассмотрены пять клинических испытаний фазы III, в которых сравнивали дегареликс с ацетатом лейпролида или гозерелином после 3 или 12 месяцев лечения. Из 1925 проанализированных пациентов исследователи сообщили, что пациенты, получавшие дегареликс, имели статистически значимое улучшение выживаемости без прогрессирования ПСА через 1 год, общей выживаемости (ОВ), симптомов, связанных с суставами, событий инфекции мочевыводящих путей через 12 месяцев и опорно-двигательного аппарата. события в 12 месяцев. Считается, что разница в OS могла быть вызвана сердечно-сосудистыми заболеваниями (ССЗ), поскольку 51% из 37 смертей произошли у 29% пациентов с исходными ССЗ.Пациенты с исходными ССЗ имели тенденцию к снижению смертности при лечении дегареликсом. Одна интересная корреляция, которая наблюдалась, заключалась в том, что смерть через 1 год предсказывалась уровнем тестостерона> 2 нг / мл и возрастом> 70, а не стадией заболевания или уровнем ПСА [18].

    Hosseini et al. Провели систематический обзор и метаанализ, сравнив шесть рандомизированных контролируемых испытаний, в которых оценивали дегареликс и агонисты ГнРГ. Было обследовано 2296 пациентов. Они обнаружили статистически значимое различие между группами: пациенты, получавшие дегареликс, демонстрировали усиление реакции в месте инъекции, снижение общей смертности, снижение IPSS на 12 неделе и снижение уровня тестостерона с 1 по 28 дни.Снижение тестостерона через 28 дней и снижение TPV не дали статистически различающихся результатов, но способствовали использованию дегареликса. Авторы пришли к выводу, что, хотя уровни тестостерона и ПСА были снижены в большей степени в первые 28 дней лечения дегареликсом по сравнению с агонистом гонадолиберина, в конечном итоге после этого периода времени эти цифры не были значительными [19].

    Дегареликс: последние достижения

    Одним из самых серьезных препятствий к использованию дегареликса является неудобство, так как его необходимо вводить каждые 4 недели.Леупролид можно назначать каждые 1–6 месяцев. В недавно опубликованном исследовании фазы II исследователи представили данные в поддержку депо-версии дегареликса, вводимой с 3-месячными интервалами. 155 пациентам, которым была показана АДТ, дегареликс-депо вводили в начальной дозе 240 мг, а затем каждые 3 месяца в дозе 360 мг или 480 мг в течение 12 месяцев с первичной конечной точкой кумулятивной кастрации тестостерона с 28 дня. –364. Было обнаружено, что доза 480 мг превосходит дозу 360 мг с совокупным подавлением тестостерона 97.2% против 88,3%. У пятидесяти процентов пациентов в группе 360 мг и у 60% пациентов в группе 480 мг наблюдались реакции в месте инъекции, но никто не прекратил лечение из-за этого. Таким образом, доза 480 мг была выбрана в качестве дозы для продолжения исследований фазы III [20].

    Дегареликс и риск сердечно-сосудистых заболеваний

    Существуют разногласия по поводу того, является ли ADT сама по себе независимым фактором риска сердечно-сосудистых заболеваний. Основная гипотеза заключается в том, что АДТ вызывает отчетливый метаболический синдром, вызванный низким уровнем тестостерона и выраженный повышенной инсулинорезистентностью, массой тела и дислипидемией, что приводит к увеличению смертности от сердечно-сосудистых заболеваний.[22,23] Есть большие исследования, которые как поддерживают, так и ослабляют эту теорию. Однако следует отметить, что сердечно-сосудистые заболевания являются наиболее частой причиной смерти мужчин с раком предстательной железы на ранней стадии, и поэтому эту теорию необходимо прояснить более подробно. [24,25] Кроме того, существует ретроспективный анализ, который предполагает, что этот риск может быть ограничен пациентами с уже существующими сердечно-сосудистыми заболеваниями. [26] Это противоречие в конечном итоге привело к тому, что FDA вместе с Американской кардиологической ассоциацией, Американским онкологическим обществом, Американской урологической ассоциацией и Американским обществом радиационной онкологии выпустило предупреждения о потенциальном риске увеличения сердечно-сосудистых событий для пациентов, получающих ADT.[22]

    По мере того, как выяснялась эффективность антагонистов ГнРГ, возрос интерес к идее, что антагонисты ГнРГ могут приводить к меньшему количеству сердечно-сосудистых событий, чем агонисты ГнРГ. В 2010 и 2011 годах были опубликованы две статьи, посвященные этой гипотезе. Сначала они проанализировали исследование CS21, сосредоточив внимание на эффекте дегареликса по сравнению с ацетатом лейпролида на интервалы QT и серьезных побочных эффектах, предполагающих аритмию. Они не обнаружили значительного увеличения интервала QT для обеих групп лечения, а также не обнаружили существенной разницы в изменении измерений QT между двумя группами.Кроме того, они не обнаружили значительной разницы в частоте новых случаев ишемической болезни сердца или аритмии между двумя группами. Они пришли к выводу, что профиль безопасности для сердечно-сосудистой системы был аналогичен как для дегареликса, так и для ацетата лейпролида. Интересно, что ишемическая болезнь сердца была ниже у пациентов, получавших одобренную FDA дозу дегареликса, по сравнению с пациентами, получавшими ацетат лейпролида (8% против 21%) [27].

    Затем был проведен более обширный анализ девяти клинических испытаний, в ходе которого изучались изменения сердечно-сосудистых событий до и после приема пациентами дегареликса, с акцентом на определение эффекта ранее существовавших сердечно-сосудистых заболеваний.Для всех пациентов они обнаружили, что частота сердечно-сосудистых заболеваний до и после лечения дегареликсом не различалась. Тем не менее, они отметили два интересных вывода. У мужчин без сердечно-сосудистых заболеваний в анамнезе частота сердечно-сосудистых событий снизилась при начале приема дегареликса, хотя эти результаты не были статистически значимыми. Для сравнения, у мужчин с ранее существовавшими сердечно-сосудистыми заболеваниями на исходном уровне сердечно-сосудистые события увеличились после приема дегареликса с 5,3 до 10,5 событий на 100 человеко-лет соответственно ( P = 0,0013) [28]. Хотя обе эти статьи представляют собой ретроспективный анализ, они предполагают, что, как и агонисты ГнРГ, антагонисты ГнРГ могут вызывать увеличение сердечно-сосудистых событий у пациентов с сердечно-сосудистыми заболеваниями в анамнезе, и что антагонисты ГнРГ могут быть более безопасными, чем агонисты ГнРГ, когда речь идет о сердечно-сосудистых событиях у этих пациентов. без сердечного анамнеза.

    Непонятно, почему антагонисты ГнРГ могут приводить к снижению сердечно-сосудистых событий в отличие от агонистов. Одна из теорий заключается в том, что рецепторы GnRH расположены на Т-клетках и могут увеличивать активацию и дифференцировку Т-клеток в фенотип Т-хелперов 1, дестабилизируя атеросклеротические бляшки. [29-31] Кроме того, ФСГ может играть роль в функции эндотелиальных клеток и Способность антагонистов ГнРГ снижать как ЛГ, так и ФСГ может быть благоприятной при сердечно-сосудистых заболеваниях. [32,33] Независимо от причины, не совсем ясно, следует ли использовать антагонисты ГнРГ вместо агонистов ГнРГ при сердечно-сосудистых заболеваниях. , и необходимы дополнительные исследования, чтобы помочь прояснить эти гипотезы.

    Дегареликс: критика и стоимость

    Хотя дегареликс в настоящее время одобрен для лечения распространенного рака простаты, его ниша все еще недостаточно определена, даже после множества клинических доказательств эффективности. Кроме того, у клиницистов есть альтернатива дегареликсу в виде лейпролида, который превосходит его по простоте инъекций (т.е. существует 6-месячный состав лейпролида), а также по меньшему количеству реакций в месте инъекции. Помимо улучшения симптомов СНМП, клинически значимый результат, подтверждающий большую эффективность дегареликса по сравнению с агонистами ГнРГ, еще предстоит доказать.Были некоторые намеки на пользу с точки зрения улучшения ОВ через 1 год и улучшения выживаемости без прогрессирования ПСА, но эти результаты не были продемонстрированы в рандомизированном клиническом исследовании фазы III. Кроме того, утверждалось, что клинические испытания дегареликса чреваты предвзятостью. Основное испытание CS21, которое привело к одобрению дегареликса, не имело сильного компаратора. Только 11% пациентов получали антиандрогены вместе с ацетатом лейпролида. Более того, в CS21 наблюдалась большая неоднородность пациентов.Клиническая стадия варьировала от локализованного заболевания с рецидивом ПСА до метастатического поражения. Эти предубеждения распространяются на каждую последующую подгруппу, объединение и метаанализ эффективности дегареликса. [34]

    Были некоторые конечные точки, которые продемонстрировали явную пользу от использования дегареликса. Клинические испытания, в которых оценивали TPV, ясно показывают преимущество дегареликса в улучшении показателей IPSS через 4, 6 и 12 недель по сравнению с агонистами GnRH. Клинически это имеет смысл, поскольку было показано, что дегареликс снижает уровень тестостерона с большей скоростью и эффективностью в первые 28 дней, чем агонисты ГнРГ.Этот клинический эффект может быть использован при метастатическом поражении позвоночника. Предотвращение обострения тестостерона имеет первостепенное значение в этой конкретной ситуации, когда возможно сжатие пуповины. Связанная конечная точка, снижение микро всплесков тестостерона, часто оценивалась. Некоторые авторы предположили, что повышение уровня тестостерона от надира до> 50 нг / дл может иметь клиническое значение. [35] Клинические последствия прорыва тестостерона с помощью агонистов ГнРГ были изучены в исследовании пациентов с неметастатическим раком простаты, в котором изучалось андроген-независимое прогрессирование.Пациенты с повышением уровня тестостерона> 0,32 нг / мл имели значительно более короткую выживаемость без андроген-независимого прогрессирования по сравнению с пациентами без этих событий [36]. Однако, когда антиандрогены использовались для отмены обострения тестостерона, корреляция с клиническим исходом (например, компрессия спинного мозга, переломы, обструкция выходного отверстия мочевого пузыря) не была значимой [37].

    Одним из факторов, который следует учитывать, является стоимость агонистов ГнРГ. Согласно Lexicomp, трехмесячный препарат ацетата лейпролида 22.5 мг составляет 5 252,86 долларов, в расчете на годовую стоимость 21 011,44 долларов. Дегареликс 120 мг стоит 914,51 доллара, а за дозу 80 мг — 586,14 доллара, что составляет 8 276,54 доллара в год. В 2016 году в сводке отчета ERG было установлено, что дополнительная рентабельность дегареликса по сравнению с трипторелином (каждые 3 месяца), гозерелином (каждые 3 месяца) и лейпрорелином (ежемесячно) составляла не менее 35 600, 28 000 и 26 200 фунтов стерлингов. соответственно, на каждый год жизни с поправкой на качество. В конце концов, Национальный институт здравоохранения и передового опыта рекомендовал использовать дегареликс в качестве варианта лечения запущенного гормонозависимого рака простаты у пациентов с метастазами в позвоночник.[38]

    Relugolix: пероральный антагонист GnRH

    Пероральный антагонист GnRH relugolix, также известный как TAK-385, в настоящее время оценивается как потенциальное средство для лечения рака простаты. Преимущества перорального антагониста ГнРГ включают предотвращение реакций в месте инъекции и возможность прекратить прием лекарства в любое время, поскольку он не предназначен для длительного высвобождения. В ходе исследования фазы II релуголикс сравнивали с дегареликсом у пациентов с локализованным раком простаты. Первичным критерием оценки был процент участников с эффективной частотой кастрации в течение 25 недель.Девяносто пять процентов пациентов, получавших релуголикс, и 89% пациентов, получавших дегареликс, оставались кастрированными в течение 25 недель [39]. Кроме того, в другом исследовании фазы II было проведено прямое сравнение релуголикса с лейпрорелином. Тридцать девять пациентов получали relugolix 80 мг один раз в день, 36 пациентов получали relugolix 120 мг один раз в день, а 20 пациентов получали 22,5 мг лейпрорелина подкожно каждые 12 недель. Девяносто два процента пациентов, получавших relugolix, и 95% пациентов, получавших лейпрорелин, достигли основного результата: устойчивый уровень тестостерона <50 нг / дл на 5–24 неделе.Побочные эффекты были сопоставимы. [40] В настоящее время проводится активная фаза III клинического исследования (NCT03085095), в котором сравнивают 120 мг релуголикса в день и 22,5 мг ацетата лейпролида каждые 3 месяца в течение 48 недель у пациентов с прогрессирующим раком простаты, чувствительным к кастрации. Первичным критерием оценки результатов исследования является частота устойчивой кастрации.

    Несмотря на то, что FDA еще не одобрило relugolix, одна проблема, связанная с пероральным антагонистом GnRH, связана с его соблюдением. По оценкам, пациенты соблюдают правила приема пероральных препаратов на уровне 79%.[41] Период полувыведения relugolix составляет 36–65 часов, что позволяет пациентам пропустить дозу; тем не менее, простота использования депо-рецептуры дегареликса может быть лучшим вариантом. [42] Если relugolix одобрен, необходимо будет оценить стоимость, соответствие и профиль побочных эффектов, чтобы определить его применимость в клинических условиях.

    Антагонисты ГнРГ: рекомендации и выводы по лечению

    Основываясь на данных, которые мы обсудили, мы не можем сказать, что дегареликс превосходит или уступает агонистам ГнРГ, когда дело касается исходов рака простаты, таких как ответ ПСА и общая выживаемость.Однако мы бы предпочли использовать дегареликс перед лейпролидом у пациентов с метастазами в позвоночник, чтобы избежать риска компрессии спинного мозга. Разница в стоимости значительна в пользу дегареликса, но это может быть перевешено реакциями в месте инъекции, связанными с дегареликсом, которые будут происходить ежемесячно. Наконец, неясно, является ли дегареликс более безопасным для пациентов с сердечно-сосудистыми заболеваниями, но есть вероятность, что это может быть так.

    Таким образом, дегареликс, по-видимому, является разумной альтернативой агонистам ГнРГ при лечении распространенного рака простаты.Будет ли дегареликс в конечном итоге одобрен в качестве альтернативного показания или будет обнаружено, что он превосходит агонисты ГнРГ по эффективности, еще предстоит выяснить. Наличие перорально доступного варианта relugolix может сыграть важную роль в лечении рака простаты в будущем. Необходимы дополнительные исследования, чтобы определить точную роль антагонистов GnRH в лечении рака простаты.

    Раскрытие финансовой информации: Авторы не имеют значительной финансовой заинтересованности или каких-либо иных отношений с производителем любого продукта или поставщиком каких-либо услуг, упомянутых в этой статье .

    Ссылки:

    1. Siegel RL, Miller KD, Jemal A. Cancer Statistics, 2017. CA Cancer J Clin. 2017; 67 (1): 7-30.

    2. Lupron Depot. Северный Чикаго, штат Иллинойс. Abbvie, 1989 (вкладыш в упаковке). https://www.accessdata.fda.gov/drugsatfda_docs/label/2014/020517s036_019732s041lbl.pdf.

    3. Firmagon. Парсиппани, штат Нью-Джерси. Ferring Pharmaceuticals, 2016 (листок-вкладыш). https://www.accessdata.fda.gov/drugsatfda_docs/label/2015/022201s009lbl.pdf.

    4. Тан О., Букулмез О. Биохимия, молекулярная биология и клеточная биология антагонистов гонадотропин-рилизинг-гормона. Curr Opin Obstet Gynecol. 2011; 23 (4): 238-244.

    5. Broqua P, Riviere PJ, Conn PM, Rivier JE, Aubert ML, Junien JL. Фармакологический профиль нового мощного антагониста гонадотропин-рилизинг-гормона длительного действия: дегареликса. J Pharmacol Exp Ther. 2002; 301 (1): 95-102.

    6. Stricker HJ. Антагонисты рилизинг-гормона лютеинизирующего гормона при раке простаты.Урология. 2001; 58 (2 Дополнение 1): 24-27.

    7. Tornoe CW, Agerso H, Senderovitz T, et al. Популяционное фармакокинетическое / фармакодинамическое (PK / PD) моделирование гипоталамо-гипофизарно-гонадной оси после лечения аналогами гонадолиберина. Br J Clin Pharmacol. 2007; 63 (6): 648-664.

    8. Клотц Л., Боккон-Гибод Л., Шор Н.Д. и др. Эффективность и безопасность дегареликса: 12-месячное сравнительное рандомизированное открытое исследование III фазы в параллельных группах у пациентов с раком простаты.BJU Int. 2008; 102 (11): 1531-1538.

    9. Tombal B, Miller K, Boccon-Gibod L, et al. Дополнительный анализ вторичной конечной точки частоты биохимических рецидивов в исследовании фазы 3 (CS21), сравнивающем дегареликс 80 мг с лейпролидом у пациентов с раком простаты, с разбивкой по исходным характеристикам. Eur Urol. 2010; 57 (5): 836-842.

    10. Damber JE, Tammela TL, Iversen P, et al. Влияние исходного уровня тестостерона на эффективность дегареликса и лейпролида: дополнительные выводы из 12-месячного сравнительного исследования III фазы у пациентов с раком простаты.Урология. 2012; 80 (1): 174-180.

    11. Шредер Ф.Х., Томбал Б., Миллер К. и др. Изменения уровней щелочной фосфатазы у пациентов с раком простаты, получающих дегареликс или лейпролид: результаты 12-месячного сравнительного исследования III фазы. BJU Int. 2010; 106 (2): 182-187.

    12. Кроуфорд Э.Д., Томбал Б., Миллер К. и др. Расширенное исследование фазы III с переходом от лейпролида к дегареликсу в одной группе: сравнение агониста и антагониста гонадотропин-рилизинг-гормона на рак простаты.J Urol. 2011; 186 (3): 889-897.

    13. Crawford ED, Shore ND, Moul JW и др. Долгосрочная переносимость и эффективность дегареликса: 5-летние результаты расширенного исследования фазы III с переходом от лейпролида к дегареликсу в одной группе. Урология. 2014; 83 (5): 1122-1128.

    14. Axcrona K, Aaltomaa S, da Silva CM, et al. Андрогенная депривационная терапия для уменьшения объема, облегчения симптомов нижних мочевыводящих путей и улучшения качества жизни у пациентов с раком простаты: дегареликс против гозерелина плюс бикалутамид.BJU Int. 2012; 110 (11): 1721-1728.

    15. Мейсон М., Мальдонадо Пихоан Х, Стейдл С. и др. Неоадъювантная депривация андрогенов для уменьшения объема простаты, облегчения симптомов нижних мочевых путей и улучшения качества жизни у мужчин с раком простаты среднего и высокого риска: рандомизированное исследование не меньшей эффективности дегареликса по сравнению с гозерелином плюс бикалутамид. Clin Oncol (R Coll Radiol). 2013; 25 (3): 190-196.

    16. Андерсон Дж., Аль-Али Дж., Вирт М. и др.Дегареликс против гозерелина (+ антиандрогенная защита от обострения) в облегчении симптомов нижних мочевыводящих путей, вторичных по отношению к раку простаты: результаты исследования фазы IIIb (NCT00831233). Urol Int. 2013; 90 (3): 321-328.

    17. Мейсон М., Ришо П., Босняк З., Мальмберг А., Нейбер А. Дегареликс против гозерелина плюс бикалутамид в краткосрочном облегчении симптомов нижних мочевыводящих путей у пациентов с раком простаты: результаты объединенного анализа. Симптомы со стороны нижних мочевыводящих путей. 2017; 9 (2): 82-88.

    18. Klotz L, Miller K, Crawford ED, et al. Результаты контроля заболевания на основе анализа объединенных данных отдельных пациентов из пяти сравнительных рандомизированных клинических испытаний дегареликса по сравнению с агонистами рилизинг-гормона лютеинизирующего гормона. Eur Urol. 2014; 66 (6): 1101-1108.

    19. Хоссейни С.А., Раджаби Ф., Акбари Сари А., Аяти М., Хейдари С., Гамари Ф. Дегареликс для лечения распространенного рака простаты по сравнению с агонистами GnRh: систематический обзор и метаанализ.MJIRI. 2016; 30: 317.

    20. Озоно С., Цукамото Т., Наито С. и др. Эффективность и безопасность трехмесячного режима дозирования дегареликса у японских пациентов с раком простаты: исследование фазы II по поиску поддерживающей дозы. JPN J Clin Oncol. 2017; 47 (5): 438-446.

    21. Labrie F, Cusan L, Gomez JL, et al. Снижение стадии комбинированной терапии флутамидом и агонистом LHRH перед радикальной простатэктомией. Cancer Surv. 1995; 23: 149-156.

    22. Левин Г. Н., Д’Амико А. В., Бергер П. и др.Андрогенная депривация при раке простаты и риске сердечно-сосудистых заболеваний: научный совет Американской кардиологической ассоциации, Американского онкологического общества и Американской урологической ассоциации: одобрен Американским обществом радиационной онкологии. CA Cancer J Clin. 2010; 60 (3): 194-201.

    23. Коллиер А., Гош С., МакГлинн Б., Холлинз Г. Рак простаты, терапия депривации андрогенов, ожирение, метаболический синдром, диабет 2 типа и сердечно-сосудистые заболевания: обзор. J Clin Oncol.2012; 35 (5): 504-509.

    24. Conteduca V, Di Lorenzo G, Tartarone A, Aieta M. Сердечно-сосудистый риск агонистов гонадотропин-рилизинг-гормона у мужчин с раком простаты: нерешенные споры. Критические обзоры по онкологии / гематологии. 2013; 86 (1): 42-51.

    25. Альбертсен П.К., Мур Д.Ф., Ши В., Лин И, Ли Х, Лу-Яо Г.Л. Влияние коморбидности на выживаемость среди мужчин с локализованным раком простаты. J Clin Oncol. 2011; 29 (10): 1335-1341.

    26. Нанда А., Чен М.Х., Браччофорте М.Х., Моран Б.Дж., Д’Амико А.В. Использование гормональной терапии при раке простаты и смертности у мужчин с застойной сердечной недостаточностью или инфарктом миокарда, вызванной ишемической болезнью сердца. Джама. 2009; 302 (8): 866-873.

    27. Смит М.Р., Клотц Л., Перссон Б.Е., Олесен Т.К., Уайлд А.А. Сердечно-сосудистая безопасность дегареликса: результаты 12-месячного сравнительного рандомизированного открытого исследования фазы III параллельной группы у пациентов с раком простаты. J Urol. 2010; 184 (6): 2313-2319.

    28. Smith MR, Klotz L, van der Meulen E, Colli E, Tanko LB. Блокаторы гонадотропин-рилизинг-гормона и риск сердечно-сосудистых заболеваний: анализ проспективных клинических испытаний дегареликса. J Urol. 2011; 186 (5): 1835-1842.

    29. Chen HF, Jeung EB, Stephenson M, Leung PC. Мононуклеарные клетки периферической крови человека экспрессируют гонадотропин-рилизинг-гормон (GnRH), рецептор GnRH и рибонуклеиновые кислоты-мессенджеры гамма-цепи рецептора интерлейкина-2, которые регулируются GnRH in vitro.J Clin Endocrinol Metab. 1999; 84 (2): 743-750.

    30. Tanriverdi F, Gonzalez-Martinez D, Hu Y, Kelestimur F, Bouloux PM. GnRH-I и GnRH-II обладают различными модулирующими эффектами на пролиферацию мононуклеарных клеток периферической крови и экспрессию мРНК гамма-цепи рецептора интерлейкина-2 у здоровых мужчин. Clin Exp Immunol. 2005; 142 (1): 103-110.

    31. Диксит В.Д., Ян Х., Удхаякумар В., Шридаран Р. Гонадотропин-высвобождающий гормон изменяет баланс Т-хелперов цитокинов у беременных крыс.Биол Репрод. 2003; 68 (6): 2215-2221.

    32. Раду А., Пишон С., Кампаро П. и др. Экспрессия рецептора фолликулостимулирующего гормона в кровеносных сосудах опухоли. N Engl J Med. 2010; 363 (17): 1621-1630.

    33. Albertsen PC, Klotz L, Tombal B, Grady J, Olesen TK, Nilsson J. Сердечно-сосудистые заболевания, связанные с агонистами и антагонистами гонадотропин-рилизинг-гормона. Eur Urol. 2014; 65 (3): 565-573.

    34. Secin FP. Сомнительные онкологические преимущества дегареликса.Урол Онкол. 2016; 34 (10): 423-426.

    35. Berges R, Bello U. Влияние нового препарата лейпрорелина на уровень тестостерона у пациентов с распространенным раком простаты. Curr Med Res Opin. 2006; 22 (4): 649-655.

    36. Morote J, Orsola A, Planas J, et al. Переопределение клинически значимых уровней кастрации у пациентов с раком простаты, получающих непрерывную терапию депривацией андрогенов. J Urol. 2007; 178 (4 Пт 1): 1290-1295.

    37. Oh WK, Landrum MB, Lamont EB, McNeil BJ, Keating NL.Предотвращает ли пероральный прием антиандрогенов перед терапией лейтеинизирующим гормон-рилизинг-гормоном у пациентов с метастатическим раком простаты клинические последствия обострения тестостерона? Урология. 2010; 75 (3): 642-647.

    38. Аттли Л., Уайт С., Гомерсалл Т. и др. Degarelix для лечения запущенного гормонозависимого рака простаты: взгляд группы обзора фактических данных на оценку единой технологии NICE. Фармакоэкономика. 2017; 35 (7): 717-726.

    39. Dearnaley D, Saltzstein DR, Sylvester JE, et al.Нео / адъювантная ADT к EBRT: рандомизированное испытание фазы 2 перорального антагониста GnRH, TAK-385 (relugolix, RGX) и дегареликса (DGX) у пациентов (pts) с раком простаты (PC). Энн Онкол. 2016; 27 (доп_6): 734П-734П.

    40. Saad F, Bailen JL, Pieczonka CM, et al. Второй промежуточный анализ (IA2) является результатом исследования фазы II TAK-385, перорального антагониста GnRH, у пациентов с раком простаты (pts). J Clin Oncol. 2016; 34 (2_suppl): 200-200.

    41. Клэкстон А.Дж., Крамер Дж., Пирс К.Систематический обзор связи между режимами дозирования и соблюдением лекарств. Clin Ther. 2001; 23 (8): 1296-1310.

    42. MacLean DB, Shi H, Faessel HM, Saad F. Медицинская кастрация с использованием исследуемого перорального антагониста GnRH TAK-385 (Relugolix): исследование фазы 1 на здоровых мужчинах. J Clin Endocrinol Metab. 2015; 100 (12): 4579-4587.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    *
    *